We narrowed to 2,481 results for: CLU
-
Plasmid#60291PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23 C3_6
Plasmid#60292PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_8
Plasmid#60294PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_11
Plasmid#60297PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_10
Plasmid#60250PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertLINGO2 inactive enhancer (LINGO2 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_14
Plasmid#60253PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertEDARADD inactive enhancer (EDARADD Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_5
Plasmid#60254PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertWSCD2 enhancer (WSCD2 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-p300 core
Plasmid#179553Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
p300 core-dCas9-CBP core
Plasmid#179559Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hEWSR1G511A-CMyc
Plasmid#50734PurposeProduces lentivirus expressing human EWSR1G511A mutant with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertEWSR1 G511A (EWSR1 Human)
UseLentiviralTagsFLAG and MycMutationChanged Gly 511 to AlaPromoterTREAvailable SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 c1222t No Stop
Plasmid#84900PurposeDONOR vector for Gateway cloning of TAF15 c1222t No StopDepositorAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
BIC-Gag-DDX3
Plasmid#233687PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.DepositorInsertDEAD-box helicase 3 (DDX3X Human)
UseRetroviralTagsGag (Murine Leukemia Virus)ExpressionMammalianPromoterhCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hEWSR1WT-CMyc
Plasmid#50733PurposeProduces lentivirus expressing human EWSR1 wild type with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorAvailable SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hEWSR1P552L-CMyc
Plasmid#50736PurposeProduces lentivirus expressing human EWSR1P552L mutant with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertEWSR1 P552L (EWSR1 Human)
UseLentiviralTagsFLAG and MycMutationChanged Pro 552 to LeuPromoterTREAvailable SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-CBP core
Plasmid#179555Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-CBP core
Plasmid#179556Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-CBP core
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-p300 core
Plasmid#179554Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only