We narrowed to 14,589 results for: RON
-
Plasmid#239742PurposePlasmid expressing mRuby from a UbC promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3774_pGEEC580_pShip-EF1a(no_intron)-mRuby2-bGH
Plasmid#239743PurposePlasmid expressing mRuby from an EF1a promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-tubgenomic-PTC62-deltaIntron3_D
Plasmid#146146PurposeMammalian Expression of tubgenomic-PTC62-delIntron3DepositorInserttubgenomic-PTC62-delIntron3
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2366 - intron GG3 - 250bp no PATC
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 GFP
Plasmid#155291PurposeLentivirus for doxycycline inducible expression of human Citron shRNA, GFP marker, based on Addgene 11652DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Drosophila Nedd2-like caspase (DRONC)
Plasmid#157778PurposeE. coli expression vector pET23 with C-term 6xHis tagDepositorInsertDrosophila Nedd2-like caspase (DRONC) (Dronc Fly)
Tags6x HISExpressionBacterialPromoterT7Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V2 O-Glycosylation site
Plasmid#120405Purposeenables eukaryotic expression of human plasma fibronectin in which the second O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
B. thetaiotaomicron 16S toehold switch sensor
Plasmid#110697PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. thetaiotaomicron 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_K599A_pBabePuro
Plasmid#58492Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408 and bearing mutation K599A (kinase domain mutant)DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationdeleted amino acids P29 to D408 and bearing mutat…Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV intron 20xGCN4 Renilla Rh1 STOP 24xMS2v5 SV40 CTE polyA
Plasmid#105000PurposeExpresses ST-Renilla-Rh1 calibration reporter in mammalian cells; note plasmid contains 24xGCN4 repeatsDepositorInsertRenilla luciferase
Tags24xGCN4 repeats (SunTag), 24xMS2v5 stem loops in …ExpressionBacterial and MammalianPromoterTetCMVAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET His6 msfGFP TEV cloning vector with BioBrick polycistronic restriction sites (9GFP)
Plasmid#48287DepositorTypeEmpty backboneTagsHis6 and msfGFPExpressionBacterialAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSEM398 - mosTI unc-119 - NNN - operon - mScarlet - tbb-2
Plasmid#182355PurposemScarlet co-expression cloning vector for mosTI(unc-119). Transgene inserted upstream of gpd-2 operon::mScarlet::tbb-2 3'UTR. MCS or Golden Gate (BsaI: tgcc - MCS - tgag)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-tdTomato+RbG and HsbG syntrons
Plasmid#172479PurposetdTomato with synthetic introns derived from the rabbit beta-globin gene and the human beta-globin geneDepositorInserttdTomato
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR30 SCR
Plasmid#216393Purposetransfer plasmid for AAV vector production of mCherry and miR scramble (no target)DepositorInsertmcherry and miR control
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233033PurposeTo Express HA tagged DjCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertDjCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only