We narrowed to 1,791 results for: plasmid for e coli
-
Plasmid#227638Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding kimA riboswitch. Plasmid confers ampicillin resistance to E. coli and erythromycin resistance to S. aureus.DepositorInsertkimA-yfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCN34e-ktrA-yfp
Plasmid#227640Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding ktrA riboswitch. Plasmid confers ampicillin resistance to E. coli and erythromycin resistance to S. aureus.DepositorInsertktrA-yfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCN38-ktrA-yfp
Plasmid#227636Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding ktrA riboswitch. Plasmid confers ampicillin resistance to E. coli and chloramphenicol resistance to S. aureus.DepositorInsertktrA-yfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
hisSUMO-mZFP57
Plasmid#87224PurposeExpress hisSUMO tagged Zinc finger protein 57 F1-F3(mouse) in E. coliDepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-SAR1
Plasmid#67388PurposeExpression of native hSar1 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-21b(+)-Is-PETase-W185A
Plasmid#112204PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1) with W185A mutations, codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6 with W185A mutation, codon optimized for expression in E. coli K12
Tags6XHISExpressionBacterialMutationW185APromoterN/AAvailable SinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)-Is-PETase-W159H-S238F
Plasmid#112203PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1) with W159H and S238F mutations, codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6 with W159H and S238F mutations, codon optimized for expression in E. coli K12
Tags6XHISExpressionBacterialMutationW159H, S238FPromoterN/AAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJJGL004
Plasmid#180608PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-PlmCasX+Region1 insertionDepositorInsertPlmCasX with DpbCasX R1 loop
UseCRISPRTags10xHis and MBPExpressionBacterialPromoterT7Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCF1148
Plasmid#222330PurposeFluorescent reporter plasmid for VeillonellaDepositorInsertbs2 gene with Veillonella parvula SKV38 mdh promoter
UseE. coli-veillonella shuttle plasmidExpressionBacterialPromoterVeillonella parvula SKV38 mdh promoterAvailable SinceOct. 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSiMPlk_N + pSiMPlk_C
Plasmid#134310PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertkanR_gp41-1 N-intein + kanR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlc_N + pSiMPlc_C
Plasmid#134312PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertcmR_gp41-1 N-intein + cmR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPla_N + pSiMPla_C
Plasmid#134314PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertampR_gp41-1 N-intein + ampR_gp41-1 C-intein
ExpressionBacterialAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlh_N + pSiMPlh_C
Plasmid#134316PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInserthygR_gp41-1 N-intein + hygR_gp41-1 C-intein
ExpressionBacterialMutationP254Q in hygR_gp41-1 N-inteinAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIMAY
Plasmid#68939PurposeE. coli/staphylococcal temperature-sensitive plasmid for allelic exchangeDepositorTypeEmpty backboneUseStaphylococcal allelic exchange vectorAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Yellow
Plasmid#160443PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Yellow chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Yellow
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Violet
Plasmid#160447PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Violet chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Violet
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1E
Plasmid#160442PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1 chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only