We narrowed to 16,291 results for: grna
-
Plasmid#101857PurposeIntroducing a gRNA targeting human TTF-1 (NKX2-1) into cellsDepositorInsertgRNA targeting TTF-1 (NKX2-1 Human)
UseLentiviralAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF005-sgRNA-shuffle-in
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantPromoterU6 promoterAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001145952)
Plasmid#76714Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMA-MsgRNA-EGFP
Plasmid#80794PurposeFor insertion of gRNA array containing 11-30 gRNA modulesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
BRD4 gRNA (BRDN0001147320)
Plasmid#77344Purpose3rd generation lentiviral gRNA plasmid targeting human BRD4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001149081)
Plasmid#76394Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001146589)
Plasmid#77861Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001147852)
Plasmid#75944Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148103)
Plasmid#75498Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ACTB_sgRNA
Plasmid#183885PurposepX459V2.0-HypaCas9 plasmid with ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDGFRA gRNA (BRDN0001148373)
Plasmid#75493Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAPK14 gRNA (BRDN0001145809)
Plasmid#77923Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERN1 gRNA (BRDN0001149471)
Plasmid#76410Purpose3rd generation lentiviral gRNA plasmid targeting human ERN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALDH18A1 gRNA (BRDN0001149056)
Plasmid#77994Purpose3rd generation lentiviral gRNA plasmid targeting human ALDH18A1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti‐puro‐OgRNA_mdxE53
Plasmid#187054PurposeSpCas9 gRNA correcting mdx4cv nonsense mutation with ABEDepositorInsertSpCas9 gRNA correcting mdx4cv nonsense mutation with ABE
UseLentiviralExpressionMammalianPromoterU6Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only