We narrowed to 9,217 results for: sgRNA
-
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available sinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M7NS_AmpR
Plasmid#119157PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with seven mismatches in the non-seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EC70197
Plasmid#209458PurposeCloning protospacers for Cas9 editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 sgRNA
UseCRISPRPromoterTaU3Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70204
Plasmid#209465PurposeCloning protospacers for Cas9 editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 sgRNA
UseCRISPRPromoterTaU6Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70188
Plasmid#209449PurposeCloning protospacers for Cas9 editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP1333
Plasmid#119268Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1159
Plasmid#119250Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable sinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4803
Plasmid#249321PurposeExpresses an sgRNA to target the KanR* site on the engineered E. coli MG1655 strain and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertsgRNA targeting the KanR* site
ExpressionBacterialMutationN/AAvailable sinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-NTC_sgRNA-hUbC-dCas9-KRAB-T2a-GFP
Plasmid#231025PurposeAll-in-one lentiviral vector (Gersbach lab design) for CRISPRi with non-targeting control sgRNADepositorInsertNon-targeting control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYC2085
Plasmid#158721PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using hygromycin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBHM2645
Plasmid#229529PurposeCarries mIAA7_opt tag, empty sgRNA, and NATR markerDepositorInsertmIAA7_opt - empty sgRNA - NATR
UseCRISPRTags2xFLAGExpressionBacterial and YeastAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p128Tol2-Olactb:Cas9-t2A-GFP, 4xU6:sgRNA
Plasmid#226834PurposeExpression of b-actin driven Cas9-GFP and U6-driven 4 sgRNAs in zebrafishDepositorInsertsCas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterOlactb and U6Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJZC603
Plasmid#62317PurposesgRNA with 2x PP7 for yeast cellsDepositorInsertsgRNA + 2x PP7 RNA binding module
ExpressionYeastPromoterSNR52Available sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair3
Plasmid#98974PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 37bp 3' overhangs. TagBFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNA sgRNAs pair 3 and Cas9(D10A)
ExpressionMammalianAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTAG4E
Plasmid#176868PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_4E
UseCRISPRMutationWTAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAG5
Plasmid#176869PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_5
UseCRISPRMutationWTAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAG6E
Plasmid#176870PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_6E
UseCRISPRMutationWTAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only