We narrowed to 3,492 results for: aaas
-
Plasmid#227476Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 1.9kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-2.4kb-USF
Plasmid#227477Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 2.4kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USP
Plasmid#227450Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgCh2
Plasmid#229023PurposeExpression of a EnAsCas12a control guide that cuts an intergenic region on chromosome 2DepositorInsertsgChr2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-ILF2-ts1
Plasmid#174262PurposeILF2 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g2
Plasmid#170825PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g1
Plasmid#170826PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 CLCN3 g1
Plasmid#170828PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA244
Plasmid#215945PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD59_v1 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-pcr4
Plasmid#193662PurposeExpression of tandem pre-sgRNA array pcr4 for LbCas12aDepositorInsertU6-PUM1-sgRNA-GHR-sgRNA-HMGA2-sgRNA-PUM2-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK1_sgRNA1
Plasmid#201630PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK1 (UCK1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-MMETn-del-gRNA1
Plasmid#185006Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertMMETn-del-gRNA1
UseCRISPRAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g1
Plasmid#155185PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA1DepositorInsertCas13d RUNX1 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only