We narrowed to 2,733 results for: GEM;
-
Plasmid#182680PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker(A6TAG)-3xFLAG. Can be used for amber codon suppression and click chemistry labeling of endogenous NFL.DepositorInsertNefl-targeting gRNA and linker(A6TAG)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(K468TAG)
Plasmid#182663PurposeExpresses mouse neurofilament light chain with a TAG codon at the position K468 and an N-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertmouse neurofilament light chain with a K468TAG mutation (Nefl Mouse)
TagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationK468TAGPromoterCMVAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K227R-HA
Plasmid#139859PurposeLentiviral expression of human DDRGK1-K227R-HADepositorAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K121R-HA
Plasmid#139852PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K116R-HA
Plasmid#139850PurposeLentiviral expression of human DDRGK1-K116R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K120R-HA
Plasmid#139851PurposeLentiviral expression of human DDRGK1-K120R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K124R-HA
Plasmid#139853PurposeLentiviral expression of human DDRGK1-K124R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K128R-HA
Plasmid#139854PurposeLentiviral expression of human DDRGK1-K128R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K146R-HA
Plasmid#139855PurposeLentiviral expression of human DDRGK1-K146R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K176R-HA
Plasmid#139856PurposeLentiviral expression of human DDRGK1-K176R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K193R-HA
Plasmid#139857PurposeLentiviral expression of the cDNA indicatedDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K224R-HA
Plasmid#139858PurposeLentiviral expression of human DDRGK1-K224R-HADepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 RR837-8GG
Plasmid#113958Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839, R837G and R838G substitutionPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL1-2
Plasmid#109006PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIB-HIS-TEV-CKS1
Plasmid#177013PurposeGenerate baculovirus for insect cell expression of CKS1 with N-terminal Polyhistidine-TEVDepositorInsertCKS1 (CKS1B Human, Synthetic)
TagsPolyhistidine-TEVExpressionInsectMutationcodon-optimised for insect cell expressionAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mCherry-FYCO1[963-1206]-mCherry
Plasmid#246264PurposeRab7 sensor acceptorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-cmyc-optiT1R3 a21-852
Plasmid#113949Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(C128S/D156A)-mCherry
Plasmid#35502PurposeAAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2(C128S/D156A)-mCherry
UseAAVTagsmCherryExpressionMammalianMutationC128S and D156APromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only