We narrowed to 2,180 results for: Pam
-
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Yeast GoldenBraid Cloning System and Toolkit
Plasmid Kit#1000000138PurposeModular cloning system for generation of high expression transcriptional units; Integrates in yeast (S. cerevisiae) genome at two different loci supporting high and stable transgene expressionDepositorAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
p35S:TN3-YFPn
Plasmid#102407Purposesplit YFP. Plant expression of p35S:TN3-YFPnDepositorInsertTN3
TagsYFPnExpressionPlantPromoter35SAvailable SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hDAT
Plasmid#32810DepositorAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry1-Lifeact-7
Plasmid#54492PurposeLocalization: Actin, Excitation: 400 / 504, Emission: 515 / 517DepositorInsertLifeact-PAmCherry1
ExpressionMammalianAvailable SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
OTV-dDAT
Plasmid#32812DepositorAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
R777-E269 Hs.RASSF9
Plasmid#70553PurposeGateway ORF clone of human RASSF9 [NM_005447.3] with stop codon (for native or N-terminal fusions)DepositorInsertRASSF9 (RASSF9 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E270 Hs.RASSF9-nostop
Plasmid#70554PurposeGateway ORF clone of human RASSF9 [NM_005447.3] without stop codon (for C-terminal fusions)DepositorInsertRASSF9 (RASSF9 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-RdLight1 (AAV9)
Viral Prep#125708-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-RdLight1 (#125708). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-RdLight1 plasmid DNA. Synapsin-driven expression of red genetically encoded dopamine sensor RdLight1. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-RdLight1 (AAV9)
Viral Prep#125707-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-RdLight1 (#125707). In addition to the viral particles, you will also receive purified pAAV-CAG-RdLight1 plasmid DNA. CAG-driven expression of red genetically encoded dopamine sensor RdLight1. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
p35S::ARA6/RabF1-YFPc
Plasmid#102408Purposesplit YFP. Plant expression of p35S::ARA6/RabF1-YFPcDepositorAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_DA2h (AAV9)
Viral Prep#140554-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_DA2h (#140554). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_DA2h plasmid DNA. Synapsin-driven expression of high-affinity GRAB_DA2h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_DA2m (AAV9)
Viral Prep#140553-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_DA2m (#140553). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_DA2m plasmid DNA. Synapsin-driven expression of 2nd generation medium affinity dopamine sensor GRAB_rDA2m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-dLight1.3b (AAV9)
Viral Prep#135762-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-syn-dLight1.3b (#135762). In addition to the viral particles, you will also receive purified pAAV-syn-dLight1.3b plasmid DNA. Syn-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_rDA1m (AAV9)
Viral Prep#140556-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_rDA1m (#140556). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_rDA1m plasmid DNA. Synapsin-driven expression of red fluorescent medium affinity dopamine sensor GRAB_rDA1m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.3b (AAV5)
Viral Prep#125560-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA. CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_rDA1h (AAV9)
Viral Prep#140557-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_rDA1h (#140557). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_rDA1h plasmid DNA. Synapsin-driven expression of red fluorescent, high affinity dopamine sensor GRAB_rDA1h. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only