We narrowed to 10,404 results for: Ada;

#131139

Encodes gRNA targeting Drosophila crk locus. Cuts 110bp upstream of the transcription start site. gRNA cloned into BbsI site of pU6-BbsI-chiRNA (Gratz et al. Genetics. 2013).

Mark Peifer

Spracklen et al Mol Biol Cell. 2019 Jul 18:mbcE19050302.

Oct. 8, 2019

Academic Institutions and Nonprofits only

#131140

Encodes gRNA targeting Drosophila crk locus. Cuts 99bp beyond the 3' UTR. gRNA cloned into BbsI site of pU6-BbsI-chiRNA (Gratz et al. Genetics. 2013).

Mark Peifer

Spracklen et al Mol Biol Cell. 2019 Jul 18:mbcE19050302.

Oct. 7, 2019

Academic Institutions and Nonprofits only

#110324

TRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

June 20, 2018

Academic Institutions and Nonprofits only

#110323

TRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

June 20, 2018

Academic Institutions and Nonprofits only

#105792

Expression of your protein of interest in fusion with non-absorbing, non-emitting Venus mutant at the C-terminus (cleavable by TEV). Negative control for FRET measurements (PMID: 17040988, 22264545).

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 12, 2018

Academic Institutions and Nonprofits only

#105775

Expression of your protein of interest in fusion with non-absorbing, non-emitting Venus mutant at the N-terminus (cleavable by TEV). Negative control for FRET measurements (PMID: 17040988, 22264545).

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 12, 2018

Academic Institutions and Nonprofits only

#89747

Expression of light-regulated p38 inhibitor, firefly luciferase-fused, lit-state mutant photosensor (AsLov2Ja.I539E), inhibitor MK3BD3-13F

Michael Courtney

Melero-Fernandez de Mera et al Nat Commun. 2017 May 12;8:15017. doi: 10

Aug. 29, 2017

Academic Institutions and Nonprofits only

#89746

Expression of light-regulated JNK inhibitor, firefly luciferase-fused, lit-state mutant photosensor (AsLov2Ja.I539E), inhibitor JIP11

Michael Courtney

Melero-Fernandez de Mera et al Nat Commun. 2017 May 12;8:15017. doi: 10

Aug. 29, 2017

Academic Institutions and Nonprofits only

#89745

Expression of light-regulated JNK inhibitor, firefly luciferase-fused, dark-state mutant photosensor (AsLov2Ja.C450A), inhibitor JIP11

Michael Courtney

Melero-Fernandez de Mera et al Nat Commun. 2017 May 12;8:15017. doi: 10

Aug. 29, 2017

Academic Institutions and Nonprofits only