We narrowed to 35,837 results for: CaS

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87146

gapAP1 targeting guide RNA E. coli , Low Phosphate Induction

Michael Lynch

March 31, 2017

Academic Institutions and Nonprofits only

#73431

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

April 4, 2016

Academic Institutions and Nonprofits only

#73430

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

April 4, 2016

Academic Institutions and Nonprofits only

#73429

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

April 4, 2016

Academic Institutions and Nonprofits only

#73433

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

March 7, 2016

Academic Institutions and Nonprofits only

#73436

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

March 3, 2016

Academic Institutions and Nonprofits only

#73432

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

March 1, 2016

Academic Institutions and Nonprofits only

#65825

zwf targeting guide RNA E. coli , Low Phosphate Induction

Michael Lynch

Sept. 22, 2015

Academic Institutions and Nonprofits only

#65818

udhA targeting guide RNA E. coli , Low Phosphate Induction

Michael Lynch

Aug. 21, 2015

Academic Institutions and Nonprofits only

#65820

Const. Promoter ProD targetting RNA E. coli Low Phosphate Induction

Michael Lynch

July 16, 2015

Academic Institutions and Nonprofits only

#65817

gltA targeting guide RNA E. coli , Low Phosphate Induction

Michael Lynch

July 9, 2015

Academic Institutions and Nonprofits only