We narrowed to 4,308 results for: PRS
-
Plasmid#101886PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceApril 30, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pSG75-β2AR-T4L-sfGFP
Plasmid#102461PurposeExpresses a fusion protein of β2 adrenergic receptor/T4 lysozyme chimera and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSG74-β2AR-sfGFP
Plasmid#102460PurposeExpresses a fusion protein of wild type β2 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSG73-β1ARts-sfGFP
Plasmid#102459PurposeExpresses a fusion protein of thermostabilized β1 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ1AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSWITCH
Plasmid#222402PurposeExpression in Streptococcus pyogenesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAGM9121_GFP11
Plasmid#153508PurposeGFP11 C-terminal Tag Donor PlasmidDepositorInsertGFP11
UseSynthetic BiologyAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
p201B Cas9
Plasmid#59177PurposeCas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
BAR
UseCRISPRPromoter2x35SAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
MCS+
Plasmid#90412PurposeA FRET sensor that report the electric potential at the inner leaflet of cell plasma membraneDepositorInsertLck10+ Venus+mcherry+ strech of positively charged amino acids
ExpressionMammalianAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MCS Lck only
Plasmid#90411PurposeA control of MCS+ that associated with cell plasma membrane only by one hydrophobic interaction at the N terminus of the FRET pair.DepositorInsertLck10+ Venus+mcherry
ExpressionMammalianAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
ILID-CAAX
Plasmid#85680PurposeExpression of untagged ILID CAAXDepositorInsertILID-CAAX
ExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVP073
Plasmid#222076PurposeeforRED visually marked spectinomycin-resistant pVS1 plasmid backbone containing the sacB eviction marker and an excisable ccdb/CmR cassette flanked by EcoRV-HindIII restriction sites.DepositorTypeEmpty backboneUseChromoprotein-marked pvs1 backboneAvailable SinceJan. 27, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP074
Plasmid#222077PurposeeforRED visually marked kanamycin-resistant pVS1 plasmid backbone containing the sacB eviction marker and an excisable ccdb/CmR cassette flanked by EcoRV-HindIII restriction sites.DepositorTypeEmpty backboneUseChromoprotein-marked pvs1 backboneAvailable SinceJan. 27, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP075
Plasmid#222078PurposeAeBlue visually marked kanamycin-resistant pVS1 plasmid backbone containing the sacB eviction marker and an excisable ccdb/CmR cassette flanked by EcoRV-HindIII restriction sites.DepositorTypeEmpty backboneUseChromoprotein-marked pvs1 backboneAvailable SinceJan. 27, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-AktAR2
Plasmid#64932PurposeEnhanced FRET-based biosensor for monitoring Akt activity.DepositorInsertAktAR2
TagsCerulean3 and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
p201G Cas9
Plasmid#59178PurposeCas9 driven by double 35S, GFP for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
sGFP
UseCRISPRPromoter2x35SAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only