We narrowed to 1,867 results for: CAG promoter
-
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN262
Plasmid#91607PurposeExpress sgRNA targeting human EPHX2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
INS-CRa-Lsg-MS2
Plasmid#247478PurposesgRNA for INS activation cloned into LsgRNA-MS2 backboneDepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0428 huDisCas7-11-R1045-GGGS-R1122-U6-pro-Gluc
Plasmid#186985PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, Gluc crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCrx-DsRed
Plasmid#13765DepositorAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-Tn7sg
Plasmid#248694PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNADepositorInsertTn7sg
ExpressionBacterialPromoterBG35Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
B95(DE3) ΔA ΔfabR ΔserB
Bacterial Strain#197655PurposeThis strain is used for expressing phosphoserine-containing proteins using genetic code expansion without buildup of prematurely truncated protein.DepositorBacterial ResistanceNoneAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pRSETB
Plasmid#55775PurposeGenetically encoded caged Ca2+DepositorInsertPACR
Tags6xHis and msEGFPExpressionBacterialPromoterT7 promoterAvailable SinceJuly 3, 2014AvailabilityAcademic Institutions and Nonprofits only