We narrowed to 4,733 results for: GCA
-
Plasmid#76401Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCIDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
NEK1 gRNA (BRDN0001146251)
Plasmid#76125Purpose3rd generation lentiviral gRNA plasmid targeting human NEK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BCJJ340
Plasmid#117502PurposeUBI10:Cas9:E9 Golden Gate Level 1 Position 2DepositorInsertBpiI:GCAA:UBI10:Cas9-3(intron):E9:ACTA:BpiI
UseCRISPRExpressionPlantPromoterAtUBI10Available SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTCas9_scr
Plasmid#207566PurposeThermoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgYAP-TAZ-3
Plasmid#229453Purposeknockout of YAP1 and WWTR1 (TAZ)DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5D B12.5 gRNA
Plasmid#90854Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5DDepositorInsertPPP2R5D (Guide Designation B12.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
WEE1 F9.4 gRNA
Plasmid#90940Purpose3rd generation lentiviral gRNA plasmid targeting human WEE1DepositorInsertWEE1 (Guide Designation F9.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
ALDH18A1 gRNA (BRDN0001145444)
Plasmid#77995Purpose3rd generation lentiviral gRNA plasmid targeting human ALDH18A1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001487050)
Plasmid#77956Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_EPHA2
Plasmid#183286PurposeAll-in-One CRISPRko system with a guide RNA that targets EPHA2 geneDepositorInsertEPHA2
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ERBB2
Plasmid#183287PurposeAll-in-One CRISPRko system with a guide RNA that targets ERBB2 geneDepositorInsertERBB2
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPD_Pnpr-4::G-CaMP6s
Plasmid#117423PurposeFor Calcium imaging, expression of G-CaMP6 under the expression of a npr-4 promoter (AVA and RIV interneurons)DepositorInsertG-CaMP6s
ExpressionWormPromoternpr-4Available SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJF131B
Plasmid#113326PurposepTet-W108 scRNA.b2, pTet-RR2-sgRNADepositorInsertW108 scRNA_MS2 and sgRNA_RR2
UseCRISPRExpressionBacterialAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
hgRNA-C21_pLKO-Hyg
Plasmid#100561PurposehgRNA-C21 in a lentiviral backboneDepositorInserthgRNA-C21
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only