We narrowed to 7,670 results for: URE
-
Plasmid#124850PurposeMutagenesis of Grin2aDepositorInsertGrin2a (Grin2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pE-SUMO CRYGD
Plasmid#80755PurposeExpression of human gamma D-crystallin in E. coliDepositorAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET12a-AL-09 FL
Plasmid#47081DepositorAvailable SinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
Flag-TRIM24-C840W
Plasmid#28136DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDRIVE-CAG-hFX-HA
Plasmid#14994DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
Plasmid#108693PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A (with D34A and D169A catalytic site mutations) for purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon, …PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) 6xHis-3xFlag-IFIT5
Plasmid#53561Purposebacterial expression of IFIT5DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
C-5545 ∆cosδε
Bacterial Strain#209018PurposeDeficient in the P2 bacteriophage packaging cos site and encoding rhamnose-inducible P4 delta (δ) and epsilon (ε) genesDepositorBacterial ResistanceHygromycinSpeciesEscherichia coliAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_DMS3g24
Plasmid#89244PurposePlasmid encodes a synthetic CRISPR containing 7 copies of a single spacer, which targets a region (gene 24) in the genome of bacteriophage DMS3DepositorInsertCRISPR
Available SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH1-CMV-HT-LC3-SV40-Hygro
Plasmid#182045PurposeLentiviral expression vector encoding HaloTag-LC3 for monitoring autophagosome closureDepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShuttle CMV RGECO-TnT
Plasmid#124643PurposeMyofilament localised red genetically encoded calcium sensor in mammalian expression vector used for AdEasy adenoviral DNA recombination.DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSOX9-dTAG-mNeonGreen-V5
Plasmid#194971PurposeAAV vector for knocking in a C-terminal tag (dTAG-mNeonGreen-V5) for human SOX9DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPing
Plasmid#47100PurposeExpresses the Ping open reading frame 1 (ORF1) and transposase from rice to allow mPing movement. The vector contains ORF1, transposase, mPing element and hph for hygromycin selection.DepositorInsertsPing cDNA
mPing
hygromycin resistance gene
UsePlant expressionTagsGFPExpressionYeastPromoterCaMV35s and StUbi3Available SinceSept. 16, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-Flag-hsDicer (E1564A)
Plasmid#41587DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET30-hDlg PDZ2
Plasmid#21692DepositorInserthDlg/SAP97 PDZ2 domain (DLG1 Human)
TagsHis6ExpressionBacterialMutationhuman hDlg/SAP97 PDZ2 domain (residues 318-405)Available SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-miR29b(m4)
Plasmid#21122DepositorInsertmiR-29b-1 (MIR29B1 Human)
ExpressionMammalianMutationG to C change at nucleotide 21 of the mature miR-…Available SinceMay 15, 2009AvailabilityAcademic Institutions and Nonprofits only -
B4-1
Plasmid#111475PurposeAla-tRNA synthetaseDepositorInsertAla-tRNA synthetase
Tags6xHisExpressionBacterialAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
B1-2
Plasmid#111464PurposeMet-tRNA synthetaseDepositorInsertMet-tRNA synthetase
Tags6xHisExpressionBacterialAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon/Von eYFP
Plasmid#137164PurposeIntersectional viral expression of EYFP in cells expressing Cre AND Flp AND VcreDepositorHas ServiceAAV Retrograde and AAV8Insert3x-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only