We narrowed to 26,209 results for: Nov
-
Plasmid#20076DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only
-
MT-AvrXa10-FT
Plasmid#234373PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-GFP-AvrXa10-GB1) with optimized activation domain (AvrXa10), targeting Arabidopsis FT locusDepositorInsertsNbGP41-GFP-AvrXa10-GB1
dCas9-24XGP41
gRNAs targeting FT locus
RFP
UseSynthetic BiologyTagsGB1, GFP, and GP41ExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and Arabidopsi…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_eCB2.0
Plasmid#164606PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in Cre positive neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterhSynAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
MiniCoopR mitfa:KIT K642E
Plasmid#118849PurposeExpresses human KIT K642E mutant and zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EFNB2 (WT)
Plasmid#200975PurposeMammalian expression plasmid for wild type, myc-tagged EFNB2DepositorInsertEFNB2 (EFNB2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-KR-Linker-eGFP
Plasmid#176066PurposeEGFP fused to the C-terminus of a KR domain & a hygromycin resistance cassetteDepositorInsertKR
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only