We narrowed to 64,366 results for: cha
-
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
Syn-ATP
Plasmid#51819PurposeOptical reporter of presynaptic ATPDepositorInsertChimeric Synaptophysin-mCherry-Luciferase
ExpressionMammalianMutationWithin WT luciferase gene, changed Threonine 214 …PromoterCMVAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CPH3486 (YCp LEU2 Rpb1 F1492A)
Plasmid#91808PurposeYeast expression of S. cerevisiae Rpb1 with a F1492A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged phenylalanine 1492 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3487 (YCp LEU2 Rpb1 S1493A)
Plasmid#91809PurposeYeast expression of S. cerevisiae Rpb1 with a S1493A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged serine 1493 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3488 (YCp LEU2 Rpb1 P1494A)
Plasmid#91810PurposeYeast expression of S. cerevisiae Rpb1 with a P1494A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged proline 1494 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3508 (YCp LEU2 Rpb1 Y1473A)
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3509 (YCp LEU2 Rpb1 T1471A)
Plasmid#91812PurposeYeast expression of S. cerevisiae Rpb1 with a T1471A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged threonine 1471 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3511 (YCp LEU2 Rpb1 P1472A)
Plasmid#91813PurposeYeast expression of S. cerevisiae Rpb1 with a P1472A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged proline 1472 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3567 (pET151_Spt6 1247-1451 R1282H)
Plasmid#91816PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with an R1282H mutationDepositorInsertSPT6 (SPT6 Budding Yeast)
Tags6xHisExpressionBacterialMutationchanged arginine 1282 to histidine; deleted resid…PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3495 (pET151_Spt6 1247-1451 K1435A)
Plasmid#91817PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with a K1435A mutationDepositorInsertSPT6 (SPT6 Budding Yeast)
Tags6xHisExpressionBacterialMutationchanged lysine 1435 to alanine; deleted residues …PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP110 [pRS416-YBR139Wp-YBR139W(N163,242Q)-PA-ADH1t]
Plasmid#106462PurposeExpresses Atg42/Ybr139w(N163,242Q) with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W(N163,242Q)
TagsPAExpressionBacterial and YeastMutationchanged Asparagines at positions 163 and 242 to G…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP129 [pRS406-YBR139Wp-YBR139W(S219A)-GFP-ADH1t]
Plasmid#106466PurposeExpresses Atg42/Ybr139w(S219A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP131 [pRS406-YBR139Wp-YBR139W(H474A)-GFP-ADH1t]
Plasmid#106467PurposeExpresses Atg42/Ybr139w(H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Histidine 474 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP133 [pRS406-YBR139Wp-YBR139W(D415A)-GFP-ADH1t]
Plasmid#106468PurposeExpresses Atg42/Ybr139w(D415A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(D415A)
TagsGFPExpressionBacterial and YeastMutationChanged Aspartate 415 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP12498 - pAAV-AiE0395m-minBglobin-SYFP2-WPRE3-BGHpA (Alias: CN2498)
Plasmid#208147PurposeDirect-expressing SYFP2 in oligodendrocytes AAV VirusDepositorInsertSYFP2
UseAAVMutationNAPromoterBeta Globin minimal promoterAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390)
Plasmid#163505PurposeDLX2.0 (3xCore version of DLX enhancer). AAV vector for strong & rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core has 100% seq conservation between mouse and humanDepositorHas ServiceAAV PHP.eBInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP12109 - pAAV-AiE0410m-minBglobin-SYFP2-WPRE3-BGHpA (Alias: CN2109)
Plasmid#208157PurposeDirect-expressing SYFP2 in oligodendrocytes AAV VirusDepositorInsertSYFP2
UseAAVMutationNAPromoterBeta Globin minimal promoterAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only