We narrowed to 8,917 results for: c myc plasmid
-
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-Bxb1-His
Plasmid#123132PurposeBacterial expression plasmid for wild-type Bxb1 with a C-terminal His-tag.DepositorInsertBxb1 integrase
Tags6x His tagExpressionBacterialPromoterT7Available SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mCherry-CAAX PuroR
Plasmid#166228PurposeLentiviral plasmid with Puromycin selection for expression of mCherry with a C-terminal CAAX polybasic sequence from KRras targeting mCherry to the plasma membraneDepositorInsertmCherry-CAAX
UseLentiviralTagsCAAXExpressionMammalianPromoterCMVAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1-EGFP
Plasmid#112857Purposeplasmid for the expression of a rat APOBEC1-EGFP C-terminal fusion proteinDepositorInsertapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 (Apobec1 Rat)
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICE-RNaseHI-WT-NLS-mCherry
Plasmid#60365PurposePlasmid for expression of bacterial RNase HI tagged with NLS-mCherry that can be used to degrade R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI
TagsNLS from SV40 T antigen and mCherryExpressionMammalianPromoterCMV-tetAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pH-nCas9-PPE
Plasmid#140447PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A for Cas9; D200N, T306K, W313F, T330P and L…Promotermaize Ubiquitin-1, OsU3Available SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.18 CMV-Luc
Plasmid#100984PurposeCMV luciferase reporter - firefly luciferase driven by CMV promoterDepositorInsertCMV
ExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsEDC4_S
Plasmid#147455PurposeMammalian Expression of HsEDC4. Please note that this plasmid does not contain the T7 promoter.DepositorInsertHsEDC4 (EDC4 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPS0263
Plasmid#133228PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with PsNifH (pOGG043), gusA (pOGG083) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0262
Plasmid#133227PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with PsNifH (pOGG043), celB (pOGG050) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only