We narrowed to 14,740 results for: Ung;
-
Plasmid#92392Purposeproduces AAV expressing Cal-light TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTADepositorInsertTM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyExpressionMammalianPromoterHuman SynapsinAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-DeltaRBP
Plasmid#135999PurposeG3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminusDepositorInsertG3BP1 (G3BP1 Human)
TagsEGFPExpressionMammalianMutationC-term of G3BP1 Deleted for Delta RBPAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ-PD-L1-EGFP
Plasmid#120933PurposeExpress PD-L1-EGFP fusion protein in mammalian cellsDepositorInsertPD-L1-EGFP
ExpressionBacterialAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-S149A
Plasmid#135998PurposeS149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-His-MS2BP-G3BP1-WT
Plasmid#136008PurposeWT G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-ASC-HA
Plasmid#41553DepositorInsertASC (PYCARD Human)
TagsHAExpressionMammalianPromoterCMV immediate-early enhancer/promoterAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFC333
Plasmid#87844PurposeAMA1 plasmid with Aspergillus optimized Cas9 and ble selection markerDepositorInsertsCas9
ble (bleomycin resistance marker)
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tag5Amyc-GSK3b WT
Plasmid#16260DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNS35 (multiAsCas12a piggyBac)
Plasmid#217336PurposepiggyBac expression of multiAsCas12aDepositorInsertmultiAsCas12a
UseCRISPRTags6xMycNLS and HA-SV40NLS-P2A-TagBFP2ExpressionMammalianMutationR1226A/E174R/S542R/K548RPromoterCAGAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-Akt DN (K179M)
Plasmid#16243DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFC330
Plasmid#87842PurposeAMA1 plasmid with Aspergillus optimized Cas9 and pyrG selection markerDepositorInsertsCas9
pyrG
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and native pro…Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYSD099
Plasmid#212923PurposeA MoClo Yeast Toolkit LEU2, CEN/ARS empty vector (GFP dropout). Contains ConL1, part234 GFP dropout, ConR2, LEU2, CEN6/ARS4, AmpR-ColE1.DepositorInsertGFP
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD300
Plasmid#212930PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pGBK1 promoter, tENO2 terminator, HIS3 selectable marker and CEN/ARS yeast origin.DepositorInsertAGA1 (AGA1 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-FLEX-eNpHR-EYFP
Plasmid#89876PurposeTo generate AAV virus that will express eNpHR-EYFP in Cre-dependent recombination under control of tetO promoterDepositorInserteNpHR=EYFP
UseAAVTagsEYFPExpressionMammalianPromoterTetOAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYSD153
Plasmid#212929PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the 111AA SCW4 TFP (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD141
Plasmid#212928PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the Aga2 signal peptide (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD080
Plasmid#212917PurposeEncodes the S. cerevisiae Aga1p yeast surface display anchor protein as a Type 3 part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA1 (AGA1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD083
Plasmid#212920PurposeEncodes the HA-tagged S. cerevisiae Sed1p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSED1 (SED1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD003
Plasmid#212900PurposeEncodes S.cerevisiae ECM14 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertECM14 (ECM14 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD023
Plasmid#212909PurposeEncodes a hybrid S. cerevisiae OST1 pre- MFalpha1 pro- signal peptide (OST1MFapp) as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD081
Plasmid#212918PurposeEncodes the HA-tagged S. cerevisiae Aga2p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA2 (AGA2 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD005
Plasmid#212902PurposeEncodes S. cerevisiae KSH1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertKSH1 (KSH1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PuroR Xlone eGFP
Plasmid#179837PurposeDoxycycline-inducible expression of eGFPDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALEN ; Donor plas…ExpressionMammalianPromoterTRE3GSAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDN-Cherry-sgRNA
Plasmid#221387Purposeepisomal (HygR), with constitutive mCherry (Psmyc) and AHT-inducible sgRNA cloning site, including Golden Gate for multiple sgRNAsDepositorInsertnone, cloning vector for introduction of targeting sequences
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-let-7a-1
Plasmid#46670DepositorInserthsa-let-7a-1 (MIRLET7A1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
SQT1665
Plasmid#78744PurposeHuman expression plasmid for LbCpf1-NLS-3xHADepositorInsertmammalian codon-optimized Lachnospiraceae bacterium ND2006 Cpf1-NLS-3xHA
UseCRISPRTagsNLS-3xHAExpressionMammalianPromoterCAGAvailable SinceJune 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tag5Amyc-GSK3b KD
Plasmid#16262DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynI-fDIO(TagBFP)-KoNLS-Cre(MtoL)
Plasmid#180587PurposeFdCdDepositorInsertCre
UseAAVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only