We narrowed to 44,340 results for: gats
-
Plasmid#70561PurposeGateway ORF clone of human RHOA [NM_001664.2] with stop codon (for native or N-terminal fusions)DepositorInsertRHOA (RHOA Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E059 Hs.EIF4EBP3
Plasmid#70343PurposeGateway ORF clone of human EIF4EBP3 [NM_003732.2] with stop codon (for native or N-terminal fusions)DepositorInsertEIF4EBP3 (EIF4EBP3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E073 Hs.EXOC4
Plasmid#70357PurposeGateway ORF clone of human EXOC4 [NM_021807.3] with stop codon (for native or N-terminal fusions)DepositorInsertEXOC4 (EXOC4 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E040 Hs.DUSP4-nostop
Plasmid#70324PurposeGateway ORF clone of human DUSP4 [NM_001394.6] without stop codon (for C-terminal fusions)DepositorInsertDUSP4 (DUSP4 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E110 Hs.IRS1-nostop
Plasmid#70394PurposeGateway ORF clone of human IRS1 [NM_005544.2] without stop codon (for C-terminal fusions)DepositorInsertIRS1 (IRS1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E120 Hs.KSR2-nostop
Plasmid#70404PurposeGateway ORF clone of human KSR2 [XM_011538224.1] without stop codon (for C-terminal fusions)DepositorInsertKSR2 (KSR2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSGE_240_pAGW_V5
Plasmid#71188PurposeGateway destination vectorDepositorTypeEmpty backboneUseGatewayTagsGal4 DBD and V5Promoteractin 5CAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGC48
Plasmid#19679DepositorInsertGateway(R2-R1)-L4440
UseRNAi; Gateway destination vectorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
R777-E108 Hs.INSRR-nostop
Plasmid#70392PurposeGateway ORF clone of human INSRR [NM_014215.2] without stop codon (for C-terminal fusions)DepositorInsertINSRR (INSRR Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E028 Hs.CNKSR1-nostop
Plasmid#70312PurposeGateway ORF clone of human CNKSR1 [NM_001297647.1] without stop codon (for C-terminal fusions)DepositorInsertCNKSR1 (CNKSR1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E018 Hs.CCND1-nostop
Plasmid#70302PurposeGateway ORF clone of human CCND1 [NM_053056.2] without stop codon (for C-terminal fusions)DepositorInsertCCND1 (CCND1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E069 Hs.EXOC2
Plasmid#70353PurposeGateway ORF clone of human EXOC2 [NM_018303.5] with stop codon (for native or N-terminal fusions)DepositorInsertEXOC2 (EXOC2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E052 Hs.ECT2-nostop
Plasmid#70336PurposeGateway ORF clone of human ECT2 [NM_018098.5] without stop codon (for C-terminal fusions)DepositorInsertECT2 (ECT2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-V5-dsRed_IDG-K
Plasmid#135262PurposeGateway destination clone of dsRed (as control) tagged with N-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertV5-dsRed
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E031 Hs.CYTH2
Plasmid#70315PurposeGateway ORF clone of human CYTH2 [NM_017457.5] with stop codon (for native or N-terminal fusions)DepositorInsertCYTH2 (CYTH2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E200 Hs.PRKAG1-nostop
Plasmid#70484PurposeGateway ORF clone of human PRKAG1 [NM_002733.4] without stop codon (for C-terminal fusions)DepositorInsertPRKAG1 (PRKAG1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E010 Hs.ARAF-nostop
Plasmid#70294PurposeGateway ORF clone of human ARAF [NM_001256196.1] without stop codon (for C-terminal fusions)DepositorInsertARAF (ARAF Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E056 Hs.EIF4EBP1-nostop
Plasmid#70340PurposeGateway ORF clone of human EIF4EBP1 [NM_004095.3] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP1 (EIF4EBP1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E026 Hs.CDK6-nostop
Plasmid#70310PurposeGateway ORF clone of human CDK6 [NM_001259.6] without stop codon (for C-terminal fusions)DepositorInsertCDK6 (CDK6 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E155 Hs.PDGFRA
Plasmid#70439PurposeGateway ORF clone of human PDGFRA [NM_006206.4] with stop codon (for native or N-terminal fusions)DepositorInsertPDGFRA (PDGFRA Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E048 Hs.E2F2-nostop
Plasmid#70332PurposeGateway ORF clone of human E2F2 [NM_004091.3] without stop codon (for C-terminal fusions)DepositorInsertE2F2 (E2F2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
9336-E07
Plasmid#234302PurposeGateway ORF Entry clone of human TGFBR1 NDN to A with stop codon (for native or N-terminal fusions)DepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
9336-E05
Plasmid#234300PurposeGateway ORF Entry clone of human Tgfbr1 with stop codon (for native or N-terminal fusions); T204D mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E06
Plasmid#234301PurposeGateway ORF Entry clone of human TGFBR1 with stop codon (for native or N-terminal fusions); K232R mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pVP084
Plasmid#222036PurposemeffBlue chromoprotein in a MultiGreen 1.0 HG entry vector.DepositorInsertmeffBlue
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP085
Plasmid#222037PurposespisPink chromoprotein in a MultiGreen 1.0 HG entry vector.DepositorInsertspisPink
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP086
Plasmid#222038PurposemRFP1e chromoprotein in a MultiGreen 1.0 HG entry vector.DepositorInsertmRFP1e
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CUP1-∆ssCPY*-mScarletI
Plasmid#221157PurposeFluorescent reporter for cytoplasmic aggregatesDepositorInsertCarboxypeptidase Y (PRC1 Budding Yeast)
TagsmScarletIExpressionYeastMutationDeletion signal peptide, G255A mutationAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CUP1-∆ssCPY*-mNeonGreen
Plasmid#221156PurposeFluorescent reporter for cytoplasmic aggregatesDepositorInsertCarboxypeptidase Y (PRC1 Budding Yeast)
TagsmNeonGreenExpressionYeastMutationDeletion signal peptide, G255A mutationAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-CAT-V5His6_E
Plasmid#146182PurposeInsect Expression of CATDepositorInsertCAT
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-CAT-PTC72_E
Plasmid#146185PurposeInsect Expression of CAT-PTC72DepositorInsertCAT-PTC72
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-cxadr
Plasmid#192734PurposeGateway entry vector encoding zebrafish cxadrDepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-nrip1a
Plasmid#192731PurposeGateway entry vector encoding zebrafish nrip1aDepositorInsertnrip1a (LOC796407 Zebrafish)
UseGateway entry vectorMutationE662Q; S895P; H967QPromoterNoneAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-erg
Plasmid#192728PurposeGateway entry vector encoding zebrafish ergDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-hcRed-V5_IDG-K
Plasmid#135239PurposeGateway destination clone of hcRed (as control) tagged with C-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInserthcRed-V5
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-V5-eGFP_IDG-K
Plasmid#135265PurposeGateway destination clone of eGFP (as control) tagged with N-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertV5-eGFP
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E337 Hs.STK3
Plasmid#70621PurposeGateway ORF clone of human STK3 [NM_006281.3] with stop codon (for native or N-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E338 Hs.STK3-nostop
Plasmid#70622PurposeGateway ORF clone of human STK3 [NM_006281.3] without stop codon (for C-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only