We narrowed to 28,317 results for: cmv promoter
-
Plasmid#227004PurposeAAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorInsertalpha synuclein A53T mutant (SNCA Synthetic, Human)
UseAAVMutationA53TPromoterCMVenh synapsinAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGK-Ptrf-mKate2
Plasmid#128765PurposeFluorescent mKate reporter for PtrfDepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-R914W_EGFP-PEST_reporter
Plasmid#172596PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-R914W mutant signaling.DepositorInsertmyc-PDGFRA-R914W (PDGFRA Synthetic, Human)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-R914WPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 Flag-Par6 delta 250-295 Flag tagged
Plasmid#24646DepositorInsertPar6c (Pard6a Mouse)
TagsFLAGExpressionMammalianMutationDeletion of the PDZ domain of Par6c (aa 250-295)Available SinceJune 2, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-CMVtight-HNF1A-FLAG-Hygro
Plasmid#183232PurposeLentiviral vector; Tet-on advanced system driving the expression of tagged HNF1ADepositorAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV Lex VP16 (F442A) HA (P#1710)
Plasmid#14595DepositorInsertLexA
TagsHA and VP16 (F442A)ExpressionMammalianMutationThe VP16 sequence contains an F442A mutation. The…Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_untagged-Puro
Plasmid#192001PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB-CMV-MCS-Puro ArfGAP1_ALPS1_ALPS2-mKate2-3NLS-P2A-EGFP-LMNB1
Plasmid#250908PurposeDual color expression of mKate2-3NLS tagged human ARFGAP1 ALPS 1-2 and EGFP tagged zebrafish LaminB1 in mammallian cell linesDepositorTagsEGFP on LMNB1 and mKate2-3xNLS on ArfGAP1ExpressionMammalianMutationARFGAP1 amino acids 192–304 onlyPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only