We narrowed to 6,255 results for: tTA
-
Plasmid#89916PurposeLinker to construct BB1 from PCR product with FS3 and FS4 (in with BsaI, out with BbsI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only
-
BB2_L_AB_syn_BbsI
Plasmid#89917PurposeLinker to construct BB2 from BB1(FS1 - FS4) with FSA and FSB (in with BbsI, out with BsaI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
BB2_L_BC_syn_BbsI
Plasmid#89918PurposeLinker to construct BB2 from BB1(FS1 - FS4) with FSB and FSC (in with BbsI, out with BsaI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
BB2_L_CD_syn_BbsI
Plasmid#89919PurposeLinker to construct BB2 from BB1(FS1 - FS4) with FSC and FSD (in with BbsI, out with BsaI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
BB2_L_DE_syn_BbsI
Plasmid#89920PurposeLinker to construct BB2 from BB1(FS1 - FS4) with FSD and FSE (in with BbsI, out with BsaI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
BB2_L_FG_syn_BbsI
Plasmid#89922PurposeLinker to construct BB2 from BB1(FS1 - FS4) with FSF and FSG (in with BbsI, out with BsaI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
BB2_L_GH_syn_BbsI
Plasmid#89923PurposeLinker to construct BB2 from BB1(FS1 - FS4) with FSG and FSH (in with BbsI, out with BsaI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB819-PKR-rhe
Plasmid#20033DepositorInsertProtein kinase R
ExpressionYeastAvailable SinceJan. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCLucf
Plasmid#37328DepositorAvailable SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Lck-mStayGold
Plasmid#234539Purposeto label the membrane of cells with a fluorescent protein (mStayGold)DepositorInsertLck-mStayGold(Ando)
UseAAVMutationNonePromoterShort CAGAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-mCherry
Plasmid#92202PurposeFluorescent protein reporter constructDepositorInsertmCherry
UseAAVExpressionMammalianPromoterTREAvailable SinceJune 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Lck-mScarlet3
Plasmid#234540Purposeto label the membrane of cells with a fluorescent protein (mScarlet3)DepositorInsertLck-mScarlet3
UseAAVMutationNonePromoterShort CAGAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Lck-mTagBFP2
Plasmid#234537Purposeto label the membrane of cells with a fluorescent protein (mTagBFP2)DepositorInsertLck-mTagBFP2
UseAAVMutationNonePromoterShort CAGAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ttx-3-mCherry-SL2-Post-SPHERE-SF-iGluSnFR
Plasmid#187100PurposeGlutamate sensor for localization to membrane contatctDepositorArticleInsertPost-SPHERE-SF-iGluSnFR
TagsmCherry-SL2ExpressionWormPromoterTtx-3Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rictor_2 shRNA
Plasmid#1854DepositorAvailable SinceApril 7, 2006AvailabilityAcademic Institutions and Nonprofits only -
pKDC.109
Plasmid#227189PurposeT7 IPTG-driven Cas9DepositorInsertSpyCas9
ExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Str-2-TagBFP-SL2-Pre-SPHERE-SF-iGluSnFR
Plasmid#187099PurposeGlutamate sensor for localization to membrane contatctDepositorArticleInsertPre-SPHERE-SF-iGluSnFR
TagsTagBFP-SL2ExpressionWormPromoterStr-2Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-elavl3_NES-rsCaMPARI-mRuby3
Plasmid#122129PurposePan-neuronal expression of rsCaMPARI in zebrafish, nucleus excludedDepositorInsertrsCaMPARI
UseZebrafish expressionTagsNES-His and mRuby3Promoterelavl3Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-3'UTR
Plasmid#136056PurposeUSP10 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTCTCTTTAGTGGCTCTTT)DepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NM23-H1
Plasmid#10956DepositorInsertNM23 (NME1 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only