We narrowed to 3,567 results for: Braf;
-
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSYC-97
Plasmid#31565DepositorInsertpCS4+-NLS-EGFP-P2A-mCherry-CAAX
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3E tdTomato
Plasmid#135210PurposeRed fluorescent tagDepositorInserttdTomato
UseSynthetic BiologyAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS-TarHom-Tol2-kanaR-cryaa-dsRed
Plasmid#74152PurposeBAC targeting cassette for pTARBAC2 with kanaR selection marker and lens-specific transgenesis marker dsRedDepositorInsertTol2-kanaR-cryaa-dsRed
Available SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3E p2a-tomato
Plasmid#135211PurposeRed fluorescent tagDepositorInserttdTomato
UseSynthetic BiologyAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
1455_pDEST_miniTol2_R4-R2_MCS
Plasmid#171794PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a Multiple Cloning Site for selection marker insertion.DepositorTypeEmpty backboneAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT2KXIGdeltaIn-MCS-Avi-EGFP-rpl10a
Plasmid#58380Purposetol2 transgenesis for biotin based TRAP - Avi tagged RibosomeDepositorInsertavi-EGFP-rpl10a
TagsAvi Tag and EGFPAvailable SinceAug. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
p5E-EF1a/b-globin
Plasmid#82582Purpose5' entry vector containing frog translation elongation factor 1 alpha (EF1a) enhancer fused to rabbit b-globin intron for semi-ubiquitous expressionDepositorInsertFrog EF1a enhancer fused to rabbit b-globin intron
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
mpeg:Rab7-stop-polyA; cmlc2:GFP
Plasmid#213738PurposeExpresses mCherry-Rab7 in the macrophage lineage of zebrafish with a green heart transgenesis markerDepositorInsertmCherry-Rab7
UseZebrafishPromotermpeg1.1Available SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E-QUAS5x
Plasmid#155113Purpose5' entry vector containing QUAS5x promoter element.DepositorInsertQUAS5x
UseGateway 5' entry vectorPromoterQUAS5x-E1bAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS-TarHom-Tol2-kanaR-cryaa-sfGFP
Plasmid#74153PurposeBAC targeting cassette for pTARBAC2 with kanaR selection marker and lens-specific transgenesis marker sfGFPDepositorInsertTol2-kanaR-cryaa-sfGFP
Available SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rab27a cds in pGem-T Easy
Plasmid#80546PurposeCan be used for in situ hybridisation or other purposesDepositorInsertrab27a (rab27a Zebrafish)
Available SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3E-mVenus
Plasmid#67719PurposeMultisite gateway entry clone for adding C-terminal fusions of mVenus (no ATG)DepositorInsertmVenus
UseGateway multisite 3' entry cloneAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
-
tol2-mpx-cxcr4b whim-gfp
Plasmid#41089DepositorInsertCXCR4b-WHIM (cxcr4b Zebrafish)
TagsGFPExpressionBacterialMutationdeleted last 19 amino acids of cxcr4bPromotermpxAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a
Plasmid#107593PurposeAn entry vector with U6a promoter driving guide RNA expressionDepositorInsertU6a promoter
UseCRISPRAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
slc6a3 probe
Plasmid#53764PurposecRNA probe to detect the slc6a3 transcriptDepositorInsertDAT
Available SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pXTm-PH domain
Plasmid#210326PurposeExpresses EGFP with PH domainDepositorInsertPH domain
UseFish expressionAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only