We narrowed to 2,353 results for: gem
-
Plasmid#92073PurposeThis is a plasmid for transcription of defective helper RNA, providing structural Semliki forest virus (SFV) proteins to package recombinant SFV genomes into virus like particles.DepositorInsertcDNA of SFV genome with deletion removing the nonstructural SFV proteins and also the viral RNA packaging signal.
UseHelper plasmid, for run-off transcription and rna…Available sinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiFUCCI(CA)5
Plasmid#223176PurposeLentiviral fluorescent ubiquitination-based cell cycle indicator (FUCCI)DepositorInsertFUCCI(CA)5
UseLentiviralTagsAzaleaB5-hCdt1(1/100)Cy(-)_P2A_h2-3-hGem(1/110)ExpressionMammalianAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pScaf
Plasmid#111401PurposePhagemid for producing DNA origami scaffolds, derived from pUC18 and M13mp18DepositorTypeEmpty backboneExpressionBacterialAvailable sinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pET-scFv-T
Plasmid#67843PurposepET-30-based vector dedicated to efficient scFv expression, which circumvents the problem of in-frame amber codons in scFvs.DepositorInsertantibody 1D8 light kappa chain
TagsHis-tagExpressionBacterialPromoterT7 promoterAvailable sinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
HBV 1.3-mer X-null replicon
Plasmid#65461Purposecontaining 1.3 units of the X-null HBV genome (subtype ayw)DepositorInsert1.3 units of the X-null HBV genome
ExpressionMammalianAvailable sinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEF1-alpha-IIb
Plasmid#27288DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertintegrin alpha IIb (ITGA2B Human)
TagsHis and V5ExpressionMammalianMutationn/aAvailable sinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-Akt1(WT)
Plasmid#86637PurposeExpresses eGFP-tagged human Akt1(WT)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAkt1 (AKT1 Human)
ExpressionMammalianAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPR-HOT_tdTomato
Plasmid#138567PurposeUniversal Cleavable Donor Plasmid for tagging with tdTomato using NHEJDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttdTomato
UseUnspecifiedAvailable sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBS-hBAF60a
Plasmid#21034DepositorInsertBAF60a (SMARCD1 Human)
UsePhagemidAvailable sinceJuly 24, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
amajLime chromoprotein
Plasmid#117843PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses amajLime chromoprotein in E. coliDepositorInsertpromoter, RBS, amajLime
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable sinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-HOT-P2A-Clover-BlastR
Plasmid#138568PurposeUniversal Cleavable Donor Plasmid for tagging with P2A-Clover-BlastR using NHEJDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertP2A-clover-BlastR
UseCRISPRAvailable sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBS-hBAF60c
Plasmid#21036DepositorInsertBAF60c (SMARCD3 Human)
UsePhagemidAvailable sinceJuly 24, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pmCherry-EGFP
Plasmid#86639PurposeExpresses mCherry-eGFP tandem (cytoplasmic)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry-EGFP
TagsmCherry-EGFPExpressionMammalianAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAVS1-Puro CAG FUCCI
Plasmid#136934Purposedonor plasmid for constitutive FUCCI expression in human cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertClover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
UseSynthetic BiologyTagsClover and mKO2ExpressionMammalianPromoterCAGAvailable sinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSicoR-eIF1a-GFP-RPL10a
Plasmid#159890PurposeExpresses GFP-RPL10a for ribosomal immunoprecipitationDepositorAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
fwYellow chromoprotein
Plasmid#117841PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses fwYellow chromoprotein in E. coliDepositorInsertpromoter, RBS, fwYellow
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable sinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF1-alpha-IIb
Plasmid#27288DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertintegrin alpha IIb (ITGA2B Human)
TagsHis and V5ExpressionMammalianMutationn/aAvailable sinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
JL054: pPB_NFκB::GFP-GEMINI(A)-P1N4_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228884PurposePiggyBac plasmid expressing the destabilized GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable sinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only