We narrowed to 7,548 results for: ski
-
Plasmid#175187PurposeFluorescent reporter for glutamate, third generation, variant 82 soluble form to express in bacteria.DepositorInsertiGluSnFR3 v82
UseSynthetic BiologyTagsHis tag, T7 leader, Xpress epitopeExpressionBacterialMutationPromoterT7Available sinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLE1
Plasmid#160802PurposeExpress POLE1DepositorInsertPOLE1 (POLE Human)
UseRetroviralTags3xFLAGExpressionMutationshPOLE_1 and shPOLE2 resistantPromoterAvailable sinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRE-TAZ-CAMTA1
Plasmid#235680PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorUseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianMutationPromoterIRES and hSynAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 SARS-CoV-2 S D614G
Plasmid#158075PurposeExpresses SARS-CoV-2 spike protein with a D614G mutationDepositorInsertSARS-CoV-2 spike (S )
UseTagsExpressionMammalianMutationD614GPromoterAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pscALPSblasti-TMPRSS2 Blasti
Plasmid#158088PurposeExpresses TMPRSS2 in mammalian cellsDepositorInsertTMPRSS2 (TMPRSS2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK-hACE2
Plasmid#161612PurposeExpression of human ACE2 in mammalian cellsDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterPGKAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX-HA-birA*-K-Ras(G12D)-IRES-Puro
Plasmid#120562PurposeExpresses HA-birA*-K-Ras G12D fusion protein in mammalian cells & for virus productionDepositorInsertKRAS4B (KRAS Human)
UseLentiviralTagsHA-birA*ExpressionMammalianMutationG12DPromoterCMVAvailable sinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS D614 soluble Spike
Plasmid#164652PurposeExpresses SARS-CoV-2 soluble Spike proteinDepositorInsertSARS-CoV-2 soluble spike (S SARS-CoV-2)
UseTagsHISExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-jYCaMP1s
Plasmid#135424PurposeYellow protein calcium sensor expressed under human Synapsin1 promoter, for AAV production or direct transfection, slow variantDepositorHas ServiceAAV1InsertjYCaMP1s
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABExpressionMutationPromoterAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64ExpressionMutationPromoterAvailable sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 SARS-CoV-2 S D614G-trunc
Plasmid#158077PurposeExpresses SARS-CoV-2 spike protein with a D614G truncated mutationDepositorInsertSARS-CoV-2 spike (S )
UseTagsExpressionMammalianMutationD614GPromoterAvailable sinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTarget_AT1R-tTA
Plasmid#222851PurposeMammalian expression plasmid encoding the human Angiotensin II type I receptor fused to the tTA transcriptional activatorDepositorInsertAT1R (AGTR1 Human)
UseTagsFLAG and tTAExpressionMammalianMutationPromoterAvailable sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only