We narrowed to 7,663 results for: ski
-
Plasmid#120566PurposeExpresses HA-birA*-N-Ras Q61K/E37A fusion protein in mammalian cells & for virus productionDepositorInsertNRAS (NRAS Human)
UseLentiviralTagsHA-birA*ExpressionMammalianMutationQ61K, E37APromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSET iGluSnFR3 v857
Plasmid#175186PurposeFluorescent reporter for glutamate, third generation, variant 857 soluble form to express in bacteria.DepositorInsertiGluSnFR3 v857
UseSynthetic BiologyTagsHis tag, T7 leader, Xpress epitopeExpressionBacterialPromoterT7Available SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-FUSN-VP16
Plasmid#183933PurposeOptogenetic PHR domain coupled to GFP, FUSN (high phase separation propensity) and VP16 activation domain; binds to CIBN upon blue light exposureDepositorExpressionMammalianMutationnonePromoterCMVAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hACE2-hygro
Plasmid#161758PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable SinceNov. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJEP313-pAAV-CMV-SaCas9-DIO-pA
Plasmid#113690PurposeA CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSET iGluSnFR3 v82
Plasmid#175187PurposeFluorescent reporter for glutamate, third generation, variant 82 soluble form to express in bacteria.DepositorInsertiGluSnFR3 v82
UseSynthetic BiologyTagsHis tag, T7 leader, Xpress epitopeExpressionBacterialPromoterT7Available SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLE1
Plasmid#160802PurposeExpress POLE1DepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Psicheck Cdk2ap1Exon1
Plasmid#178028Purposeexpression vector to test translation efficiency by luciferase reporter.DepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseLuciferase; NonviralTagsLuciferaseExpressionMammalianPromoterCloned inAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX-HA-birA*-K-Ras(wildtype)-IRES-Puro
Plasmid#120561PurposeExpresses HA-birA*-K-Ras wildtype fusion protein in mammalian cells & for virus productionDepositorAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 SARS-CoV-2 S D614G
Plasmid#158075PurposeExpresses SARS-CoV-2 spike protein with a D614G mutationDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX-uORF-HA-birA*-H-Ras(wildtype)-IRES-Puro
Plasmid#120559PurposeExpresses HA-birA*-H-Ras wildtype fusion protein in mammalian cells & for virus productionDepositorAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE-TAZ-CAMTA1
Plasmid#235680PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscALPSblasti-TMPRSS2 Blasti
Plasmid#158088PurposeExpresses TMPRSS2 in mammalian cellsDepositorAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only