We narrowed to 1,967 results for: RNAi
-
Plasmid#180393PurposeProducing AAV that encodes mouse Stk16 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only
-
AAV.CBA.YFP.miR-E_shTgm5-1
Plasmid#180394PurposeProducing AAV that encodes mouse Tgm5 shRNA-1 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-2
Plasmid#180395PurposeProducing AAV that encodes mouse Tgm5 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-3
Plasmid#180396PurposeProducing AAV that encodes mouse Tgm5 shRNA-3 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-P2A-BlastDYK-Rluc_miR
Plasmid#163341PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface marker and a DYK-tagged Blasticidin selection markerDepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-CAG-CD90.2-Rluc_miR
Plasmid#163331PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Rluc_miR
Plasmid#163330PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Rluc_miR
Plasmid#163329PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Cd247A_miR
Plasmid#163328PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-CAG-CD90.2-Cd247A_miR
Plasmid#163326PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Cd247A_miR
Plasmid#163327PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD90.2-Cd247A_miR
Plasmid#163325PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the human FTH1 promoter.DepositorAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hPGK-CD90.2-Cd247A_miR
Plasmid#163324PurposeRetroviral vector for knockdown of murine CD247A (TCR zeta) and expression of a CD90.2 surface marker under control of the human PGK promoter.DepositorAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CBSH3+ 3m shRNA-1
Plasmid#160067Purpose3-point mutation negative control for CBSH3+ shRNA-1 targeting collybistin isoforms with SH3+ domain (plasmid 160066)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGGcTGaTTaCAACAAGGATTG (mutations shown in lower c…Promotermouse U6 promoterAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA3
Plasmid#160213PurposeKnock Down MYDSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA3 targeting collybistin MYD-CBSH3- isoforms (Plasmid #160212)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGTATGACCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA2
Plasmid#160211PurposeKnock Down MTLSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA2 targeting collybistin MTL-CBSH3-isoforms (Plasmid #160210)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGACGTTGCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only