We narrowed to 2,400 results for: fas
-
Plasmid#163905PurposeFull length mouse ADAP1 for purification from insect cellsDepositorAvailable sinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pZA8
Plasmid#158486PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 L17E/D481V with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, D481V, STOP codonAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHCas9-Nours
Plasmid#107733PurposeEscherichia coli- S. cerevisiae shuttle plasmid harbors a Cas9 gene, a natMX6 and URA3 selection markers used in S. cerevisiaeDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionYeastMutationHuman optimizedPromoterTEF1Available sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-hSyntenin2a
Plasmid#89421PurposeTwo-hybrid systemDepositorAvailable sinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-At4CL-PhCHS-MsCHI
Plasmid#73392PurposeExpresses three enzymes to convert phenylpropanoic acids to flavanones in vivoDepositorInsertsAt4CL
PhCHS
MsCHI
ExpressionBacterialPromoterT7Available sinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plekhm1- PH2 pGEX 4T2-GST
Plasmid#73834PurposeExpress human Plekhm1 (PH2 domain) in bacterial cellsDepositorInsertPlekhm1 (PLEKHM1 Human)
TagsGstExpressionBacterialMutationto vector was cloned PH2 domain of human Plekhm1…Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plekhm1- PH1 pGEX 4T2-GST
Plasmid#73833PurposeExpress human Plekhm1 (PH1 domain) in bacterial cellsDepositorInsertPlekhm1 (PLEKHM1 Human)
TagsGstExpressionBacterialMutationto vector was cloned PH1 domain of human Plekhm1…Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plekhm1 -C101 pGEX 4T2-GST
Plasmid#73832PurposeExpress human Plekhm1 (S956 to end domain) in bacterial cellsDepositorInsertPlekhm1 (PLEKHM1 Human)
TagsGstExpressionBacterialMutationto vector was cloned 101 aa from human Plekhm1 (S…Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNB695
Plasmid#60144PurposeDisintegrator plasmid encoding MET17 promoter driven green beetle luciferase with nuclear localization signal (NLS) and ClpXP degron tag (ssrA).DepositorInsertGrLuc
TagsClpXP degron and Nuclear localization signal (NLS…ExpressionYeastPromoterMET17prAvailable sinceDec. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNB697
Plasmid#60146PurposeDisintegrator plasmid encoding MET17 promoter driven red beetle luciferase with nuclear localization signal (NLS) and ClpXP degron tag (ssrA).DepositorInsertRdLuc
TagsClpXP degron and Nuclear localization signal (NLS…ExpressionYeastPromoterMET17prAvailable sinceDec. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUAST td tomato Rab35 CA
Plasmid#58383Purposeexpression of drosophila tdtomato-Rab35 constitutively active mutantDepositorInsertRab35 (Rab35 Fly)
Tagstd tomatoExpressionInsectMutationQ67L (constitutive active)PromoterGAL4Available sinceJuly 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUAST YFP mouse Rab35 CA
Plasmid#46015DepositorInsertRab35 (Rab35 Mouse)
UseDrosophilaTagsYFPExpressionInsectMutationQ67L (constitutively active)PromoterGAL4Available sinceJuly 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJH102
Plasmid#243725PurposeExpresses a chimeric form of TBRG4, where the region between residue 110 and 351 is replaced by a 250-residue XTEN linkerDepositorInsertTBRG4(1-110aa)-XTEN250-TBRG4(351aa-stop) (TBRG4 Human)
UseLentiviralMutationThe region between residue 110 and 351 of TBRG4 i…Available sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1-Halo HRD
Plasmid#207084PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous NBS1 locus.DepositorInsertHaloTag followed by a LoxP-PuroR cassette flanked by human NBS1 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable sinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC3.1_CMV_oROS-G_LF(C199S)
Plasmid#216112PurposeExpresses the loss-of-function mutations C199S of the genetically encoded green fluorescent hydrogen peroxide sensor oROS-G in mamalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertoROS-G_LF(C199S)
ExpressionMammalianPromoterCMVAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-LIC_GRWD1:1-446
Plasmid#210876PurposeInsect expression of full-length human GRWD1. N-terminal 6X His tag with thrombin protease cleavage site.DepositorInsertGRWD1:M1-V446 (GRWD1 Human)
TagsMGSSHHHHHHSSGLVPRGSExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Hook3(1-522)-GFP-Psc-StrepII
Plasmid#111861PurposeC-terminal GFP tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal GFP-Psc-StrepII tag.DepositorInsertHook3(1-552)-GFP (HOOK3 Human)
TagsGFP, Psc tag, and Strep tagExpressionInsectMutationOptimised for expression in SF9 cellsAvailable sinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-hSyntenin2b
Plasmid#89422PurposeTwo-hybrid systemDepositorAvailable sinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-crab-eating macaque cGASdeltaN-HA
Plasmid#186870PurposeDoxycycline-dependent expression of crab-eating macaque cGAS gene in mammalian cells by retroviral transductionDepositorInsertCrab-eating macaque cGAS truncation mutant (160-522 a.a.) with C-terminal HA tag (CGAS Macaca fascicularis, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only