We narrowed to 2,389 results for: fas
-
Plasmid#58383Purposeexpression of drosophila tdtomato-Rab35 constitutively active mutantDepositorInsertRab35 (Rab35 Fly)
Tagstd tomatoExpressionInsectMutationQ67L (constitutive active)PromoterGAL4Available sinceJuly 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUAST YFP mouse Rab35 CA
Plasmid#46015DepositorInsertRab35 (Rab35 Mouse)
UseDrosophilaTagsYFPExpressionInsectMutationQ67L (constitutively active)PromoterGAL4Available sinceJuly 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
NBS1-Halo HRD
Plasmid#207084PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous NBS1 locus.DepositorInsertHaloTag followed by a LoxP-PuroR cassette flanked by human NBS1 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable sinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATG16L1 HRD
Plasmid#207537PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG16L1 locus in human cellsDepositorInsertHaloTag with internal PuroR cassette flanked by human ATG16L1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-TCAB1 HRD
Plasmid#207535PurposeHomologous recombination donor to insert HaloTag at the N-terminus of the endogenous TCAB1 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human TCAB1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATM-Halo HRD
Plasmid#207082PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous ATM locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP1muA single guide RNA
Plasmid#230030Purposeguide RNA for AP1muA tagging at the C-terminus in pX459DepositorInsertAP1M1 guide (AP1M1 Human)
UseCRISPRAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
RNF168-Halo HRD
Plasmid#207080PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF168 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
ExpressionMammalianPromoterNoneAvailable sinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-LIC_GRWD1:1-446
Plasmid#210876PurposeInsect expression of full-length human GRWD1. N-terminal 6X His tag with thrombin protease cleavage site.DepositorInsertGRWD1:M1-V446 (GRWD1 Human)
TagsMGSSHHHHHHSSGLVPRGSExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Hook3(1-522)-GFP-Psc-StrepII
Plasmid#111861PurposeC-terminal GFP tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal GFP-Psc-StrepII tag.DepositorInsertHook3(1-552)-GFP (HOOK3 Human)
TagsGFP, Psc tag, and Strep tagExpressionInsectMutationOptimised for expression in SF9 cellsAvailable sinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-hSyntenin2b
Plasmid#89422PurposeTwo-hybrid systemDepositorAvailable sinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-crab-eating macaque cGASdeltaN-HA
Plasmid#186870PurposeDoxycycline-dependent expression of crab-eating macaque cGAS gene in mammalian cells by retroviral transductionDepositorInsertCrab-eating macaque cGAS truncation mutant (160-522 a.a.) with C-terminal HA tag (CGAS Synthetic, Macaca fascicularis)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL_SEC31A:1-338
Plasmid#210925PurposeInsect expression of human SEC31A fragment M1 to T338. N-terminal 6X His tag with TEV cleavage.DepositorInsertSEC31A:M1-T338 (SEC31A Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBD-BirA_RFWD3:425-774
Plasmid#210884PurposeInsect expression of human RFWD3 fragment S425 to E774. N-terminal biotin acceptor peptide tag and C-terminal 6X His tag.DepositorInsertRFWD3:S425-E774 (RFWD3 Human)
TagsGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUAST YFP Rab18 DN
Plasmid#58722Purposeexpression of drosophila YFP Rab18 dominant negative mutantDepositorAvailable sinceSept. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSems StayGold-2xFYVE
Plasmid#222948PurposeExpression of HRS 2xFYVE tagged with StayGold in mammalian cellsDepositorAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL_CDC20:161-477
Plasmid#210943PurposeInsect expression of human CDC20 fragment S161 to P477. N-terminal 6X His tag with TEV cleavage.DepositorInsertCDC20:S161-P477 (CDC20 Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBD-BirA_RACK1:1-317
Plasmid#210889PurposeInsect expression of full-length human RACK1. N-terminal biotin acceptor peptide tag and C-terminal 6X His tag.DepositorInsertRACK1:M1-R317 (RACK1 Human)
TagsGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
R-Q111R-N122D
Plasmid#167178PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-R variant with reverted Q111R and N122D mutations in Sf9 cellsDepositorInsertsATP1A1-R-Q111R-N122D
ATP1B1
ExpressionBacterial and InsectMutationChanged R at 111 to Q and changed D at 122 to NPromoterP10 and PHAvailable sinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only