We narrowed to 9,052 results for: sgRNA
-
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…PromoterAspergillus fumigatus U3 (RNAPIII).Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-smyhc1_977
Plasmid#140867PurposesgRNA synthesis vector for smyhc1_977 (zebrafish slow myosin heavy chain 1).DepositorInsertzebrafish smyhc1_977 sgRNA for in vitro transcription (smyhc1 Zebrafish, Synthetic)
UseIn vitro transcription of sgrnasAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB
Plasmid#247329PurposeVector encoding human codon-optimized engineered DelIscB driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHvL1P4GA
Plasmid#112028PurposeExpresses sgRNA in barleyDepositorInsertTaU6-LacZ-sgRNA
UseUnspecifiedAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-1
Plasmid#74435PurposesgRNA expression vector for mouse Dedd gene targeting intron 5DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-2
Plasmid#74436PurposesgRNA expression vector for mouse Dedd gene targeting intron 4DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
p206-Switch-ON
Plasmid#217885PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B8
Plasmid#172849PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B8 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 1-1) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B7
Plasmid#172848PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B7 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B9
Plasmid#172850PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B9 (Zhong et al, eLife 2021), mEGFP translational phase (2-2), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-2) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p207-Switch-ON (FRT)
Plasmid#217886PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
p205-5'-Switch-ON
Plasmid#217884PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B10
Plasmid#172851PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B10 (Zhong et al, eLife 2021), mEGFP translational phase (2-stop), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-stop) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ctrl)
Plasmid#69215PurposeAdvanced lentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; control, MLL-sgRNA + luciferase-sgRNADepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV promoter
P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRCA938 - pBA904 Puro-T2A-GFP PLAGL1_g1 CRISPRa guide guide (pRCA360 backbone)
Plasmid#238189PurposeLentiviral CRISPR guide vector expressing a PLAGL1 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA816 - pBA904 Puro-T2A-GFP ZNF296 g6 CRISPRa guide (pRCA360 backbone) 694
Plasmid#238179PurposeLentiviral CRISPR guide vector expressing a ZNF296 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only