We narrowed to 9,217 results for: sgRNA
-
Plasmid#171799PurposePICASSO: Expression scaffold for second subcloning step to properly co-express paired dCas9-fusion+sgRNADepositorInsertPICASSO: expression scaffold for proper dCas9-fusion + sgRNA expression
UseCRISPRAvailable sinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px330-GAPDH
Plasmid#136940PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GAPDH (GAPDH Human)
UseCRISPRExpressionMammalianAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-1
Plasmid#86128PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
SaCas9_sgRNA_expression_in_pBluescript
Plasmid#122090PurposeU6 driven SaCas9 sgRNA expression vector for cloning own guidesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSaCas9 tracr (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRExpressionMammalianPromoterU6Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRCA377 - pBA904 Puro-T2A-GFP CD55 CRISPRa guide 1 (pRCA360 backbone)
Plasmid#238168PurposeLentiviral CRISPR guide vector expressing CD55 targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_SRD5A1-mcherry
Plasmid#159780PurposeS. pyogenes sgRNA collocated with pegRNA targeting human SRD5A1 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspacer of sgRNA targeting SRD5A1 gene (SRD5A1 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B10
Plasmid#172851PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B10 (Zhong et al, eLife 2021), mEGFP translational phase (2-stop), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-stop) encoding mEGFP
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL007-NANOG-sgRNA
Plasmid#175555PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspCas9-nuclease and sgRNA against mouse NANOG STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2842C
Plasmid#139324PurposePlasmid expressing a sgRNA to introduce BRCA2 R2842C using base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA to insert BRCA2 R2842C using base editing
ExpressionMammalianPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E638K
Plasmid#139327PurposePlasmid expressing a sgRNA to introduce BRCA1 E638K using base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA to insert BRCA1 E638K using base editing
ExpressionMammalianPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 V572I
Plasmid#139321PurposePlasmid expressing a sgRNA to introduce BRCA2 V572I using base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA to insert BRCA2 V572I using base editing
ExpressionMammalianPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-LAMP1
Plasmid#207787PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of LAMP1 for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting C-terminus of LAMP1 (LAMP1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only