We narrowed to 10,075 results for: crispr plasmids
-
Plasmid#228551PurposeTemplate for PCR amplification for gRNA cloning. The PCR product recombines in vivo with a PCRs products from pOliSpec3' and oligo-spacer amplifications, to clone gRNA plasmidDepositorInsertTruncated 5' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOliSpec3'
Plasmid#228550PurposeTemplate for PCR amplification for gRNA cloning. The PCR product recombines in vivo with a PCRs products from pOliSpec5' and oligo-spacer amplifications, to clone gRNA plasmid.DepositorInsertTruncated 3' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pADsacA
Plasmid#158649PurposeConstitutive transcription of sacA crRNA and GFPDepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_221
Plasmid#169142PurposeConstitutive expression of EGFP and sgRNAs targeted to EGFP for measurement of activity of AsCas12a\EnAsCas12a.DepositorInsertEGFP , EGFP sgRNA
UseCRISPR and LentiviralAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHTganA-Cpf1
Plasmid#158647PurposeConstitutive transcription of FnCpf1 and ganA crRNADepositorInsertCpf1, ganA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterP43Available SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBsacA
Plasmid#158650PurposeConstitutive transcription of sacA crRNADepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYJ42-XLone-SOX17
Plasmid#131085PurposeDox-induced expression of SOX17DepositorInsertSOX17 (SOX17 Human)
ExpressionMammalianAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695&557_3xP3-DsRed1-SV40 (Tandem 1_2 gRNAs)
Plasmid#243012PurposeFor cloning two gRNAs in tandem after BspQI digestion under An. gambiae U6.695 and U6.557 promoters.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKS1612
Plasmid#239530PurposeExpress CpPT1 membrane protein cargo without mTurqoise2 marker fused to PTS1 and Pex22(1-36)-mRuby2; chromosomal integration by CRISPRDepositorInsertCpPT1(52-408)-SKL
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p202_LTJ_sgRNACD45.2_R1
Plasmid#82672PurposesgRNA targeting murine CD45.2 region 1. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD45.2 region 1
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pATF1-donor
Plasmid#112328PurposeCRISPR donor plasmid to tag human transcription factor ATF1 with GFPDepositorInsertATF1 homology arms flanking EGFP-IRES-Neo cassette (ATF1 Human)
UseCRISPRMutationhg38:12:50819876:T>A, hg38:12:50819888:T>C,…Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
p236_LTJ_sgRNAFoxp3sf/J
Plasmid#82676PurposesgRNA targeting murine Foxp3 scurfy. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting Foxp3 sf/J
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
INT_GFPsp
Plasmid#212144PurposePreparatory plasmid for operon integration into the genome using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC, green fluorescent protein
ExpressionBacterialPromoterpJ23119Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_GFPsp_CamRcargo
Plasmid#212143PurposePreparatory plasmid for gene disruption into the genome using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC, green fluorescent protein
ExpressionBacterialPromoterpJ23119Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-sgRNA-RFP
Plasmid#166005PurposeBacterial expression of dCas9 (aTc control) and sgRNA (arabinose control)DepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-EBFP2-NLS (pRW1447)
Plasmid#216219PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi construct with nuclear-localized EBFP2 expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only