We narrowed to 23,639 results for: Sele
-
Plasmid#55131PurposeLocalization: Membrane Scaffold, Excitation: 587, Emission: 610DepositorInsertSequestosome1 (SQSTM1 Human)
TagsmCherryExpressionMammalianMutationStarts at amino acid 86 of Sequestosome1PromoterCMVAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-LaminA-N-18
Plasmid#54139PurposeLocalization: Nuclear Envelope, Excitation: 487, Emission: 509DepositorAvailable SinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-N1-VAPA(1-242) K87D/M89D
Plasmid#18875DepositorAvailable SinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
Kusabira Orange-N1 (KO)
Plasmid#54793PurposeLocalization: N1 Cloning Vector, Excitation: 548, Emission: 561DepositorTypeEmpty backboneTagsKusabira OrangeExpressionMammalianAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
GGE367
Plasmid#120736PurposePart of GoldenGate Yarrowia lipolytica toolkit for assembling an expression plasmid for Y. lipolytic yeast. Antibiotic resistance marker for selection after transformation in Y. lipolytica (Marker_hph)DepositorInsertMarker_hph
UseCloning/assembly plasmidAvailable SinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pESC-TYR
Plasmid#222484PurposeCo-expression of two genes in yeast with FLAG and MYC tags and TYR1 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-THR
Plasmid#222479PurposeCo-expression of two genes in yeast with FLAG and MYC tags and THR1 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-ADE
Plasmid#222480PurposeCo-expression of two genes in yeast with FLAG and MYC tags and ADE2 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-ARG
Plasmid#222481PurposeCo-expression of two genes in yeast with FLAG and MYC tags and ARG1 selectionDepositorTypeEmpty backboneTagsFLAG and MycExpressionYeastAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only