We narrowed to 17,508 results for: phen
-
Plasmid#31274DepositorInsertRecG-EGFP
TagsEGFPExpressionMammalianAvailable SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKS2236
Plasmid#37833DepositorInsertYFP
TagsYFPExpressionWormPromoternhx-2Available SinceJan. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPEE27
Plasmid#128367PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 3, a small gene-free region. Contains the nourseothricin resistance marker (NAT)DepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
G1S-HA-pCB6
Plasmid#74373PurposeMammalian expression of a G1S mutant HA from the X:31 strain of influenza virusDepositorInsertHA
ExpressionMammalianMutationG1SPromoterCMVAvailable SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
G1V-HA-pCB6
Plasmid#74372PurposeMammalian expression of a G1V mutant HA from the X:31 strain of influenza virusDepositorInsertHA
ExpressionMammalianMutationG1VPromoterCMVAvailable SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSKA322
Plasmid#101676Purposeempty backbone with chloramphenicol resistanceDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPEE36
Plasmid#128376PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 7, a small gene-free region. Contains the NEO resistance markerDepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPEE38
Plasmid#128378PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 4, a small gene-free region. Contains the HYG resistance marker.DepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPEE32
Plasmid#128372PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 3, a small gene-free region. Contains the NEO resistance markerDepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPEE20
Plasmid#128363PurposeDominant marker in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 4, a small gene-free region. Contains the amdS2 counterselectable marker.DepositorTypeEmpty backboneUseUnspecifiedPromoterTEF1Available SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPEE35
Plasmid#128375PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 6, a small gene-free region. Contains the NEO resistance markerDepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPEE41
Plasmid#128381PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 7, a small gene-free region. Contains the HYG resistance marker.DepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPEE40
Plasmid#128380PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 6, a small gene-free region. Contains the HYG resistance marker.DepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPEE37
Plasmid#128377PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site 3, a small gene-free region. Contains the HYG resistance marker.DepositorTypeEmpty backboneUseUnspecifiedPromoterACT1Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only