We narrowed to 282 results for: Trp53;
-
Plasmid#228929PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i3 (Trp53 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-beta
Plasmid#88847PurposeCRISPR KO of Trp53DepositorInsertTrp53 (Trp53 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-alpha
Plasmid#88846PurposeCRISPR KO of Trp53DepositorInsertTrp53 (Trp53 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-sgTrp53-sgAtrx-EFS-Cre
Plasmid#189977PurposeExpresses Cre cDNA and sgRNAs targeting murine Trp53 and AtrxDepositorInsertsgTrp53, sgAtrx, Cre recombinase
UseAAV, Cre/Lox, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available sinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgKdm6a#4-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209061PurposeEntry vector that endcodes sgRNAs against mouse Kdm6a, Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertKDM6A
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgC0111-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209062PurposeEntry vector that encodes sgRNAs against mouse Rb1, Trp53, Rbl2, and a non-targeting sgRNA (C0111) and CMV Cre recombinase.DepositorInsertnon-targeting sgRNA (C0111)
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch2#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209069PurposeEntry vector that encodes sgRNAs against mouse Notch2, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch2, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available sinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionTagsExpressionMutationPromoterU6Available sinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131461PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of WT H3F3A and oncogenic PDGFRA D842V and TRP53DepositorInsertH3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationPdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-K27M-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131462PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A K27M, PDGFRA D842V, and TRP53DepositorInsertH3F3A-K27M-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A K27M, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-G34R-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131463PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A G34R, PDGFRA D842V, and TRP53DepositorInsertH3F3A-G34R-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A G34R, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available sinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX21
Plasmid#46849PurposeGene targeting to generate Trp53 Platform (PLF) mouseDepositorInsert129/Ola mouse Trp53 gene, Puro and attP sites
UseMouse TargetingTagsExpressionMutationattP flanked PGK-NeoPromoterAvailable sinceAug. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
pX62
Plasmid#46854PurposeTOP Hupki-puro2A-G245S plasmid to introduce mutant p53 to PLF ESC or MEFs by IMCEDepositorInsertattB-Puro-2A and Hupki p53 G245S (TP53 Mouse, Human)
UseTagsExpressionMammalianMutationG245SPromoterAvailable sinceAug. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX68
Plasmid#46857PurposeOP Hupki-puro2A-A138V plasmid to indroduce mutant p53 to PLF ESC or MEFs by IMCEDepositorInsertattB-Puro-2A and Hupki p53 A138V (TP53 Mouse, Human)
UseTagsExpressionMammalianMutationp53 A138VPromoterAvailable sinceAug. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-PR.CC9
Plasmid#192932PurposepShuttle.CC9 encoding sgRNAs targeting Trp53 and Rb1 genesDepositorUseGateway-compatible vectorTagsExpressionMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-PRL.Cre
Plasmid#192934PurposepShuttle.Cre encoding sgRNAs targeting Trp53, Rb1 and Rbl2 genesDepositorUseGateway-compatible vectorTagsExpressionMutationPromoterU6Available sinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits