We narrowed to 5,490 results for: crispr cas9 grna plasmid
-
Viral Prep#73179-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiCRISPRv2 (#73179). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2 plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2.DepositorAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only
-
Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (Lentiviral Prep)
Viral Prep#92379-LVPurposeReady-to-use Lentiviral Prep particles produced from Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (#92379). In addition to the viral particles, you will also receive purified Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR activation screening in human cells. Contains 56,762 sgRNAs, targeting 18,885 genes. Concentrated lentiviral particles carrying set A of the Calabrese human CRISPRa sgRNA activation library in backbone XPR_502 (P65 HSF) .DepositorAvailable SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73178-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiGuide-Puro (#73178). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiGuide-Puro plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Use on cells that are stably expressing Cas9 to make edits across 19,114 genes in the human genome.DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#1-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124283PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124285PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#2-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124284PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
NFATc3-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124288PurposesgRNA against human NFATc3DepositorInsertNFATc3 nuclear factor of activated T cells (NFATC3 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
NFATc4-CRISPR-gRNA#exon5-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124290PurposesgRNA against huiman NFATc4DepositorInsertNFATc4 nuclear factor of activated T cells (NFATC4 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
NFATc4-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124289PurposesgRNA against human NFATc4DepositorInsertNFATc4 nuclear factor of activated T cells (NFATC4 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Col7A1-CRISPR-gRNA#exon3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124287PurposesgRNA against human Col7A1DepositorInsertCollagen type VII alpha 1 chain (COL7A1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Col7A1-CRISPR-gRNA#exon2-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124286PurposesgRNA against human Col7A1DepositorInsertCollagen type VII alpha 1 chain (COL7A1 Human)
UseCRISPRAvailable SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2
Plasmid#74009PurposeTissue-specific knock-out in zebrafish, Cas9 and GFP driven by a UAS promoterDepositorInserts5x UAS
Cas9
T2A
GFP
U6 promoter
UseCRISPRAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDY156: SUZ12 px330 sgRNA Cas9 plasmid
Plasmid#170792PurposeThis plasmid encodes Cas9 and a sgRNA that targets the SUZ12 locus; to be used with pDY153DepositorInsertCas9
ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti.Cas9.BFP.sgRNA.parental
Plasmid#196715PurposeSortable WT-SpCas9 expression and guide cassette (1-vector system).DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Blast_HP1beta_gRNA
Plasmid#127908PurposeWT Cas9 Vector with Blasticidin Selection Marker targeting the 5' end of the human HP1beta geneDepositorInsertgRNA for Human 5' HP1beta
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-tRNApromo-sgRNA-espCas91_1
Plasmid#167210PurposePlasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only