80,773 results
-
Plasmid#200402PurposeEntry vector for closed-loop ADAR-based RNA sensors (DART VADAR). Expresses TagBFP constitutively. Expresses mNeonGreen and MCP-ADAR upon target detectionDepositorInsertClosed-loop DART VADAR sensor entry cassette
UseSynthetic BiologyExpressionMammalianAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-WT Split GFP + Sense IRES
Plasmid#69909PurposeExpresses a GFP circular RNA containing the sense EMCV IRES in mammalian cellsDepositorAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-scFv-GCN4-sfGFP-GB1-NLS-iLID-dWPRE
Plasmid#121966PurposeExpresses fusion of single chain variable fragment recognizing SunTag, fluorescent protein sfGFP, and iLID which upon light activation binds to sspB.DepositorInsertscFv-GCN4
UseLentiviralTagssuperfold GFP-GB1-NLS-iLIDExpressionMammalianPromoterSFFVAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Flag RagC(GD)/RagB(CTD) chimera
Plasmid#112774Purposeexpress Flag-RagC (G domain) fused with with RagB (C terminal domain)DepositorInsertFlag-RagC (G domain) fused with RagB (C terminal domain) (RRAGB Human)
TagsFlagExpressionMammalianAvailable SinceOct. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Flag RagB(GD)/RagC(CTD) chimera
Plasmid#112773Purposeexpress Flag-RagB (Gdomain) fused with RagC (C terminal domain)DepositorInsertFlag-RagB (G domain) fused with RagC (C terminal domain) (RRAGC Human)
TagsFlagExpressionMammalianAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-Laforin Myc R171H
Plasmid#84671Purposemammalian expression and/or retrovirus preparationDepositorArticleAvailable SinceNov. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga11
Plasmid#196059PurposeEncodes a G alpha subunit (GNA11) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDESTmycDDX17
Plasmid#19876DepositorAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
SPLICS Mt-ER- PM Short P2A
Plasmid#164110PurposeDetect the short Plasma membrane-mitochondria-Endoplasmic reticulum contactDepositorInsertSplit GFP and YFP PM- Mt-ER Short P2A
ExpressionMammalianAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Actb KI
Plasmid#131479PurposeEndogenous tagging of βactin: N-terminal (amino acid position: D2)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
LeGo-Renilla-BLAST
Plasmid#122276PurposeLentiviral vector for stable expression of Renilla luciferase.DepositorInsertRenilla luciferase
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-flex-GFP-4x6T
Plasmid#196418PurposeCre-dependent AAV expression of GFP preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertGFP
UseAAV and Cre/Lox; Astrocyte-selectiveExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEFIRES-P-mTagBFP-KDEL
Plasmid#87163PurposeFluorescent marker of endoplasmic reticulum (ER)DepositorInsertmTagBFP-KDEL
TagsBip signal peptide (Homo sapiens) and mTagBFP-KDE…ExpressionMammalianPromoterEF-1 alphaAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-ccdB-Nanoluc
Plasmid#87075PurposeLentiviral Gateway-compatible expression vector backbone with a C-terminal Nanoluc luciferaseDepositorTypeEmpty backboneUseLentiviralTagsNanoluc luciferaseExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn1-synaptophysin-mCherry-V5
Plasmid#250167PurposeNeuronal overexpression of synaptophysin fused to mCherryDepositorInsertSynaptophysin
ExpressionMammalianAvailable SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Nav1.6(WT, Y371C)-HA
Plasmid#239765PurposeExpresses TTX-resistant (Y371C) variant of mouse Nav1.6WT with a C-terminal HA tag in mammalian cells.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-NRBP1-FL-N-FLAG
Plasmid#222675Purposeoverexpressing full length NRBP1 with N-terminal FLAGDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-TSC22D2-Nterm-C-FLAG
Plasmid#222683Purposeoverexpressing N-terminus truncation of TSC22D2 with C-terminal FLAGDepositorInsertTSC22D2 (TSC22D2 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTSC22D2 N-terminus truncationAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-M-MLV(WT) (DRR1012)
Plasmid#217799PurposeVariant CE1 construct with wild-type M-MLV revese transcriptase (RT), expressed from CMV or T7 promotersDepositorInsertPCV2-XTEN-nSpCas9-BPNLS-M-MLV-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only