We narrowed to 7,437 results for: val
-
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX_305_Ovalbumin
Plasmid#184924PurposeLentiviral vector for expressing Ovalbumin. Also expresses the puromycin resistance gene as a selectable marker.DepositorInsertOvalbumin (OVAL Chicken)
UseLentiviralExpressionMammalianMutationOur vector has an A188T mutation that does not im…PromoterPGKAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
R2x2_VAL88
Plasmid#160761PurposeExpresses R2x2_VAL88 in bacterial cellsDepositorInsertR2x2_VAL88
Tags6xHisExpressionBacterialMutation10-residue mutations of Rsmn2x2_5_6Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
GW1-PercevalHR
Plasmid#49082PurposeMammalian expression vector (CMV promoter) of PercevalHR, a fluorescent sensor of ATP-to-ADP ratio.DepositorInsertPercevalHR
ExpressionMammalianAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
FUGW-PercevalHR
Plasmid#49083PurposeLentiviral vector for PercevalHR, a fluorescent sensor of ATP-to-ADP ratio.DepositorInsertPercevalHR
UseLentiviralExpressionMammalianAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
GW1CMV-Perceval
Plasmid#21737Purposecan be used to monitor the ATP:ADP ratio during live-cell imagingDepositorInsertPerceval (fluorescent ATP:ADP sensor)
Tags5'UTRExpressionMammalianMutationimproved Kozak sequenceAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRsetB-PercevalHR
Plasmid#49081PurposeBacterial expression vector of N-terminal His-tagged PercevalHR, a fluorescent sensor of ATP-to-ADP ratio.DepositorInsertPercevalHR
Tags7xHisExpressionBacterialAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only