We narrowed to 280 results for: Blasticidin-encoding lentiviral vector
-
Plasmid#231939PurposeVector for generating stable lines allowing expression of ZNF207-3xFLAGDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394
Plasmid#128387PurposeExpresses a split firefly luciferase reporter based on the full length, human Gal8 and CALCOCO2, which interact following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsCLuc394 and NLuc398ExpressionMammalianPromoterEFS and IRESAvailable SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-CKB
Plasmid#73501PurposegRNA expression vector (with mKate2)DepositorInsertmKate2-T2A-Bsd
UseCRISPR and LentiviralTagsNLSExpressionMammalianPromoterCAGAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-FGF6-V5
Plasmid#124090PurposeFGF6-V5 tagged expression vectorDepositorInsertFGF6 (FGF6 Human)
UseLentiviralTagsV5Mutation3 silent SNPs: (189) C>G, (366) T>C and (41…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti NLuc398-G8NCRD IRES G8NCRD-CLuc394
Plasmid#128386PurposeExpresses a split firefly luciferase reporter based on the N terminal carbohydrate recognition domain of human galectin 8, which concentrates inside endosomes following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsC-terminal luc2 fragment and N-terminal luc2 frag…ExpressionMammalianMutationN terminal carbohydrate recognition domain fused …PromoterEF1A and IRESAvailable SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX304-GW-DCK*-IRES-GFP
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only