We narrowed to 2,526 results for: T2A
-
Plasmid#242034PurposeN-terminal segment of the blue-light-controlled split PS Intein tTA gene expression system, co-expressing mTagBFP2 under the hTERT promoter.DepositorInsertSplit PS Intein-N tTA
TagsmTagBFP2ExpressionMammalianMutationThe CMV promoter was replaced with the hTERT prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT26
Plasmid#223398PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by AtU3; BASTA for plants select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT28
Plasmid#223400PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and sgRNA was driven by OsU3; Hygromycin for plant select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT29
Plasmid#223401PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by OsU3; BASTA for plant select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT30
Plasmid#223402PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 and the sgRNA was driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-whiteCopyCatcher
Plasmid#174062PurposeCopyCatcher insertion donor for the white locusDepositorInsertwhite (w Fly, Synthetic)
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MTK4a_010
Plasmid#123823PurposeEncodes a nuclear localized mRuby2 coexpression cassette as a Type 4a part to be used in the MTK systemDepositorInsertT2A::NLS::mRuby2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK4a_011
Plasmid#123824PurposeEncodes a nuclear localized iRFP670 coexpression cassette as a Type 4a part to be used in the MTK systemDepositorInsertT2A::NLS::iRFP670
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK4a_021
Plasmid#123834PurposeEncodes a nuclear localized and destabilized mRuby2 coexpression cassette as a Type 4a part to be used in the MTK systemDepositorInsertT2A::NLS::mRuby2::PEST4d
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRT043-CLYBL-DDdcas9-VPH
Plasmid#158091PurposeInducible expression of dCas9-VPH from the CLYBL locus for CRISPR activationDepositorInsertCLYBL-CAG-DDdCas9VPH-T2A-GFP
UseTALENExpressionMammalianPromoterCAGAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEA038
Plasmid#224547PurposeBlast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vectorDepositorInsertFKBP12F36V degron (dTAG system), blasticidin, 2xHA tag
UseMouse TargetingAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-FLEX-CybSEP2-WPRE
Plasmid#207661PurposeMonitoring neuropeptide releaseDepositorInsertCytochrome b-561 (Cyb561 Mouse)
UseAAVMutationHistidine 86 and 159 to alanines, inserted 2 X SE…PromoterhSynapsinAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBA439
Plasmid#85967PurposePerturb-seq vector backboneDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMK1334
Plasmid#127965PurposesgRNA expression vector compatible with CROP-Seq and imaging screensDepositorInsertEF1a-Puro-T2A-2xmycNLS-WPRE-mU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX601-mCherry
Plasmid#84039PurposeStaphylococcus aureus (SaCas9) conjugated with mCherryDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry
Plasmid#159655PurposeEmpty backbone for cloning gRNA sequences for DNA targeting. Contains an T2A linked H2B mCherry nuclear reporter.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-Cas9-Act3.0
Plasmid#178954PurposeIt consists of a catalytically active Cas9 nuclease and MS2-SunTag-activators activation complex (ScFv-sfGFP-2xTAD), enabling simultaneous genome editing and gene activation.DepositorInsertzCas9-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-GFP
Plasmid#159654PurposeEmpty backbone for cloning gRNA sequences for DNA targeting. Contains an T2A linked H2B GFP nuclear reporter.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only