We narrowed to 2,426 results for: 683
-
Plasmid#222302PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK2 and FHIP2A) in a pBIG1a vectorDepositorUseTagsStrepII-PscExpressionInsectMutationPromoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only
-
Anti-Lgi1 [N283/7R-2b]
Plasmid#222172PurposeMammalian Expression Plasmid of anti-Lgi1 (Mouse). Derived from hybridoma N283/7.DepositorInsertAnti-Lgi1 (Mus musculus) recombinant mouse monoclonal antibody. (Lgi1 Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_2
Plasmid#195135PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_1
Plasmid#195134PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3a- pMK293 (mAID-mCherry2-Hygro) plasmid
Plasmid#192236Purposeknockin donor vector of mAID-mCherry2-Hygro to C-terminus of endogenous human eIF3aDepositorInserteIF3a-knockin-homology arm-mAID-mCherry2-Hygro (EIF3A Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3a- pMK289 (mAID-mClover-NeoR) plasmid
Plasmid#192235Purposeknockin donor vector of mAID-mClover-NeoR to C-terminus of endogenous human eIF3aDepositorInserteIF3a-knockin-homology arm-mAID-mClover-NeoR (EIF3A Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-KLRC1-Fc(DAPA)-AviTag-6xHis
Plasmid#156532PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertKLRC1 (KLRC1 Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GNAS-T225P
Plasmid#116406PurposeLentiviral expression of GNAS T225PDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-KCNT2/Slo2.1/Slick K+ channel [N11/33R]
Plasmid#114496PurposeMammalian Expression Plasmid of anti-KCNT2/Slo2.1/Slick K+ channel (Mouse). Derived from hybridoma N11/33.DepositorInsertanti-KCNT2/Slo2.1/Slick K+ channel (Mus musculus) recombinant mouse monoclonal antibody (Kcnt2 Mouse)
UseTagsExpressionMammalianMutationPromoterdual CMVAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GALNTL5_p.D221E
Plasmid#81563PurposeGateway Donor vector containing GALNTL5 , part of the Target Accelerator Plasmid Collection.DepositorInsertGALNTL5 (GALNTL5 Human)
UseGateway entry vectorTagsExpressionMutationC124R; D221EPromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ABCB9_p.R281L
Plasmid#82840PurposeGateway Donor vector containing ABCB9, part of the Target Accelerator Plasmid Collection.DepositorInsertABCB9 (ABCB9 Human)
UseGateway entry vectorTagsExpressionMutationR281RL; 582_590delISLVSQEPVinsVCARAWATL; 592_595d…PromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GALNTL5_p.G309E
Plasmid#81449PurposeGateway Donor vector containing GALNTL5 , part of the Target Accelerator Plasmid Collection.DepositorInsertGALNTL5 (GALNTL5 Human)
UseGateway entry vectorTagsExpressionMutationC124R; G309EPromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001149267)
Plasmid#76312Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-hGeminin
Plasmid#199344Purposemodified version of the eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA plasmid (addgene #86613) where the C-terminus of the eSpCas9 enzyme was fused to amino acids 1 – 110 of human GemininDepositorInsertATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110) (GMNN S. pyogenes)
UseTagscas9 c-term fused to hgemenin 1-110 fragmentExpressionMammalianMutationcas9 c-term fused to hgemenin 1-110 fragmentPromotercbhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianMutationPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CUX1_NUTM1
Plasmid#205800PurposeExpress mEGFP-tagged fusion protein, CUX1_NUTM1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only