We narrowed to 18,548 results for: Mut
-
Plasmid#40987DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pBABEpuro-ERBB2 C331S
Plasmid#40989DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A G567S
Plasmid#239214PurposeExpresses CDK11A with G567S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11A with G567S resistance mutation (CDK11A Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 567 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BRAF-REG-T241P-Halo
Plasmid#202549PurposeMammalian expression construct encoding the BRAF regulatory (REG) domain (AA 1-435) with a C-terminal HaloTag. The REG domain contains the RASopathy mutation, T241P, within its cysteine-rich domain.DepositorInsertBRAF regulatory (REG) domain (AA 1-435) (BRAF Human)
TagsHaloTagExpressionMammalianMutationThreonine 241 mutated to prolinePromoterCMVAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2 C299S
Plasmid#40988DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
LVXN-Neo-NSD2-E1099K
Plasmid#86011Purposeexpress NSD2 E1099K mutant in mammalian cellsDepositorInsertNSD2 E1099K mutant (NSD2 Human)
TagsFlag tag D Y K D D D D KExpressionMammalianMutationE1099K; K1002R (please see depositor comments bel…PromoterCMVAvailable SinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-E112A
Plasmid#110215PurposeExpression in mammalian cells of of full-length SPRTN protein carrying E112A mutation, a catalytically-dead mutant, and Flag-tag at N-terminus.DepositorInsertSPRTN (SPRTN Human)
TagsFlagExpressionMammalianMutationE112A, P296L (see depositor comments below)Available SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRM56 tet-AR(1-707)C617Y
Plasmid#183504PurposeLentiviral vector expressing a doxycycline-inducible truncated DNA-binding mutant androgen receptor (AR mutant C617Y)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationTruncated mutant AR; spans AR 1-707 aa, and conta…PromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B G579S
Plasmid#239213PurposeExpresses CDK11B with G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 579 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B D562A
Plasmid#239217PurposeExpresses CDK11B with D562A kinase inactivating mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B with D562A kinase inactivating mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Aspartic acid 562 to AlanineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSm5En2CER4(#457)
Plasmid#184090Purposecyclofen-inducible chicken EN2 (mut) activation via mammalian cell transfection or mRNA synthesisDepositorInsert5myc-chkEn2(C>S)-ERT2
UseSynthetic BiologyTags5xMycExpressionMammalianMutationchkEn2: C175S; ERT2: G400V, M543A, L544A, deleted…PromotersCMV+SP6Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22gcfUbm5En25EE4PCh(#552)
Plasmid#184092Purposecyclofen-inducible chicken EN2 (mut) activation in zebrafish permanent transgenicDepositorInsert5myc-chkEn2(5E)-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationchkEn2: S150E, S151E, S153E, S155E, S156E; ERT2: …PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22Ubm4Eng2bKRPC(#493)
Plasmid#184091Purposecyclofen-inducible fish Eng2b (mut) activation in zebrafish permanent transgenicDepositorInsert4myc-ZfEng2b(WW>KK)-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags4xMycMutationZfEng2b: W141K, W144K; ERT2: G400V, M543A, L544A,…PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B-p58 G579S
Plasmid#239216PurposeExpresses CDK11B p58 isoform with G579S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11B p58 isoform with G579S resistance mutation (CDK11B Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 579 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pKP2186
Plasmid#167637PurposeExpress FepA T13C, I14P . Please note that mutation numbers are not based on start codon of insert.DepositorInsertfepA T13C, I14P
ExpressionBacterialMutationfepA with T13C, I14P mutations (Mutations are T3…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP2187
Plasmid#167640PurposeExpress FepA V15C, I14P . Please note that mutation numbers are not based on start codon of insert.DepositorInsertfepA V15C, I14P
ExpressionBacterialMutationfepA with V15C, I14P mutations (Mutations are I36…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP2189
Plasmid#167644PurposeExpress FepA T17C, I14P . Please note that mutation numbers are not based on start codon of insert.DepositorInsertfepA T17C, I14P
ExpressionBacterialMutationfepA with T17C, I14P mutations (Mutations are I36…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only