We narrowed to 2,309 results for: neurod
-
Plasmid#141324PurposeGateway cloning of TARDBP-A315TDepositorInsertTARDBP-A315T (TARDBP Human)
UseGateway cloningTagsExpressionMutationA315TPromoterAvailable sinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-LRRK2
Plasmid#229019PurposeExpression of untagged full length human LRRK2 in mammalian cellsDepositorInsertLeucine-rich repeat kinase 2 (LRRK2 Human)
UseTagsno tags (untagged)ExpressionMammalianMutationnonePromoterCMVAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorInserthuman ATP13A2 (ATP13A2 Human)
UseLentiviralTagsExpressionMutationD508N , D962NPromoterCMVAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 D962N
Plasmid#171821Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 D962NDepositorInserthuman ATP13A2 (ATP13A2 Human)
UseLentiviralTagsExpressionMutationWT, D508NPromoterCMVAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT1
Plasmid#66818PurposedCas9 fused to BFP and the human DNMT1 catalytic domainDepositorInsertdCas9-BFP-DNMT1, catalytic domain (DNMT1 )
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APPP1-mGFP
Plasmid#196695PurposeAs mBFP-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmEGFP and mtagBFP2ExpressionMammalianMutationLys to Val substitution at position 612PromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1, 5F-L YFP
Plasmid#84913PurposeMammalian expresion of TDP-43 NLS1, 5F-L YFPDepositorInsertTDP-43 (TARDBP Human)
UseTagsYFPExpressionMammalianMutationK82A, R83A, K84A, F147L, F149L, F194L, F229L, F23…PromoterCMVAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N-flag_huntingtin_full-length_Q23
Plasmid#111723PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ23 (polyQ repeat)PromoterCMV and P10Available sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable sinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q145
Plasmid#111731PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ145 (polyQ repeat)PromoterCMV and P10Available sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseTagsExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…PromoterAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pADC10-SETXhel
Plasmid#193056PurposeBaculovirus expression of human Senataxin helicase domain for protein productionDepositorInsertSenataxin (SETX Human)
UseTagsFlagExpressionInsect and MammalianMutationcodon optimized for insect cell expressionPromoterhybrid p10 (insect) and CMV (human) expressionAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF2
Plasmid#141189PurposeExpresses GFP-GIGYF2 in mammalian cells, can be used to make inducible cell lineDepositorInsertGIGYF2 (GIGYF2 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q23
Plasmid#111726PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ23 (polyQ repeat)PromoterCMV and P10Available sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag TBK1
Plasmid#20648DepositorInsertTBK1 (TBK1 Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1A KI
Plasmid#131480PurposeEndogenous tagging of CaV2.1, P/Q: N-terminal (amino acid position: G10)DepositorUseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-N-flag_huntingtin_full-length_Q139
Plasmid#111738PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ139 (polyQ repeat)PromoterCMV and P10Available sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only