We narrowed to 13,204 results for: BASE
-
Plasmid#124177PurposepiggyBac-based Dox-inducible expression of EsrrbDepositorAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pALPS_3'LTR GFP@gag start SFFV-
Plasmid#101337PurposeRepaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted.DepositorInsertGFP
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBRC169
Plasmid#79670PurposeDsREDmonomer-based BiFC vector for transient expression of RC (169-225) in plants.DepositorTypeEmpty backboneUseReporter plasmidTagsDsRED-monomer (169–225)/RC169ExpressionPlantPromoterCaMV35SAvailable SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2190
Plasmid#67535PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked KlLEU2 marker, integration into S. cerevisiae XI-2 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2193
Plasmid#67542PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked natMX marker, integration into S. cerevisiae X-2 chromosomal location, USER site for cloning, amp resistance.DepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-puro-OsAID (p5109)
Plasmid#239359PurposepPOTv7 based plasmid template for addition of a Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin Inducible Degradation domain
UseBacterialPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-MRPL50-VC155
Plasmid#182373PurposemVenus-based mito-riboBiFC vector (Negative control)DepositorAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKF-D2irTNP2AG-T2APuroR-5kwh
Plasmid#128255PurposeMammalian linearizer gene circuit based on negative feedback in a Flp-In expression system controlling the PuroR gene.DepositorInserthTetR::P2A::EGFP::T2A::PuroR
UseSynthetic Biology; Flp-in expression vectorExpressionMammalianPromoterCMV-D2ir promoterAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only