We narrowed to 13,204 results for: BASE

#124177

piggyBac-based Dox-inducible expression of Esrrb

Hans Schöler

Adachi et al Cell Stem Cell. 2018 Aug 2;23(2):266-275

March 28, 2019

Academic Institutions and Nonprofits only

#101337

Repaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted.

Jeremy Luban

McCauley et al Nat Commun. 2018 Dec 13;9(1):5305. doi:

March 14, 2019

Academic Institutions and Nonprofits only

#79670

DsREDmonomer-based BiFC vector for transient expression of RC (169-225) in plants.

Yutaka Kodama, Masamitsu Wada

Kodama et al Plant Mol Biol. 2009 May;70(1-2):211-7.

Aug. 18, 2016

Academic Institutions and Nonprofits only

#67535

EasyClone system-based yeast integrative vector carrying loxP-flanked KlLEU2 marker, integration into S. cerevisiae XI-2 chromosomal location, USER site for cloning, amp resistance

Irina Borodina

Stovicek et al J Ind Microbiol Biotechnol. 2015 Sep 16.

March 10, 2016

Academic Institutions and Nonprofits only

#67542

EasyClone system-based yeast integrative vector carrying loxP-flanked natMX marker, integration into S. cerevisiae X-2 chromosomal location, USER site for cloning, amp resistance.

Irina Borodina

Stovicek et al J Ind Microbiol Biotechnol. 2015 Sep 16.

March 10, 2016

Academic Institutions and Nonprofits only

#239359

pPOTv7 based plasmid template for addition of a Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycin

Mark Carrington

Alexandra et al bioRxiv 2025.06.17.660065

July 16, 2025

Academic Institutions and Nonprofits only

#207093

pX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

April 30, 2025

Academic Institutions and Nonprofits only

#207091

pX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

March 29, 2024

Academic Institutions and Nonprofits only

#182373

mVenus-based mito-riboBiFC vector (Negative control)

Chunghun Lim

Lee et al BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1

March 30, 2022

Academic Institutions and Nonprofits only

#128255

Mammalian linearizer gene circuit based on negative feedback in a Flp-In expression system controlling the PuroR gene.

Gabor Balazsi

Farquhar et al Nat Commun. 2019 Jun 24;10(1):2766. doi:

Jan. 2, 2020

Academic Institutions and Nonprofits only