We narrowed to 77,447 results for: Rest
-
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3/ TO myc-cCE-bio (cCE-bio)
Plasmid#82473PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal biotin tagged mRNA capping enzyme, inactive formDepositorInsertMyc-NES-mCE (Wt, NLS deletion)-TEV-Bio (Rngtt Mouse, Synthetic)
TagsTEV-Biotin and mycExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C (NT809)
Plasmid#50866PurposeExpresses human NKCC1 P676C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475)
Plasmid#50875PurposeExpresses human NKCC1 I674C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI674C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N680C A734C (NT816)
Plasmid#50870PurposeExpresses human NKCC1 N680C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationN680C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L737C (NT523)
Plasmid#50891PurposeExpresses human NKCC1 L737C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationL737C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C A734C (NT810)
Plasmid#50867PurposeExpresses human NKCC1 P676C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N672C (NT474)
Plasmid#50873PurposeExpresses human NKCC1 N672C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationN672C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C (NT443)
Plasmid#50877PurposeExpresses human NKCC1 P676C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N731C (NT505)
Plasmid#50885PurposeExpresses human NKCC1 N731C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationN731C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 V673C (NT437)
Plasmid#50874PurposeExpresses human NKCC1 V673C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationV673C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I677C (NT467)
Plasmid#50878PurposeExpresses human NKCC1 I677C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI677C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I678C (NT445)
Plasmid#50879PurposeExpresses human NKCC1 I678C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI678C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L736C (NT522)
Plasmid#50890PurposeExpresses human NKCC1 L736C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationL736C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C (NT441)
Plasmid#50876PurposeExpresses human NKCC1 A675C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationA675C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I730C (NT504)
Plasmid#50884PurposeExpresses human NKCC1 I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A735C (NT509)
Plasmid#50889PurposeExpresses human NKCC1 A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationA735C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 S679C (NT447)
Plasmid#50880PurposeExpresses human NKCC1 S679C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationS679C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N680C (NT468)
Plasmid#50881PurposeExpresses human NKCC1 N680C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationN680C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C A734C (NT841)
Plasmid#50864PurposeExpresses human NKCC1 A675C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationA675C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 S679C I730C (NT838)
Plasmid#50869PurposeExpresses human NKCC1 S679C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationS679C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C I730C (NT835)
Plasmid#50863PurposeExpresses human NKCC1 I674C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI674C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I677C A734C (NT813)
Plasmid#50868PurposeExpresses human NKCC1 I677C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI677C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUCM-AAVS1-TO-hNGN2
Plasmid#105840PurposeDonor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuronDepositorInsertsUseCRISPR and TALENPromoterCAG, EF-1alpha, and TRE3GAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX MLKL(wt)--2A-mCherry-puro
Plasmid#231974PurposeTet inducible expression of DmrB-Mlkl with mCherry to induce WT Mlkl expressionDepositorAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-STING-sh5
Plasmid#127647PurposeKnock-down of human STINGDepositorInsertSTING shRNA (STING1 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
TGFB1_pLX307
Plasmid#98377PurposeLentiviral expression of TGFB1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.eC
Plasmid#201903Purposenon-standard AAV2 rep-AAV-PHP.eC cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.eC VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-MTS-TagBFP-P2AT2A-EGFP-NLS-P2AT2A-mCherry-PTS1
Plasmid#87829PurposeHigh-efficient mammalian expression vector for co-expression of BFP-, EGFP- and mCherry-tagged proteins using P2AT2A. MTS, NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsMTS
NLS
PTS1
ExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
MYC_pLX307
Plasmid#98363PurposeLentiviral expression of MYCDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only