We narrowed to 4,467 results for: Erf
-
Plasmid#39520DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-H-Ras_V12-S35
Plasmid#39505DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-H-Ras_V12-G37
Plasmid#39506DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-H-Ras_V12-C40
Plasmid#39508DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-H-Ras_V12-G37
Plasmid#39518DepositorAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-H-Ras_V12-C40
Plasmid#39521DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_G12-E
Plasmid#25761PurposeEntry vector with TRE promoter driving mouse G alpha 12 miR30-based shRNA.DepositorInsertG alpha 12 miR-shRNA (Gna12 Mouse)
UseGateway CloningAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-H-Ras_V12-A38
Plasmid#39519DepositorAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a spIgE-3xFLAG-DR18 IRES mNeonGreen-P2A-Puro
Plasmid#248038PurposeConstitutively expresses 3xFLAG tagged DR18 with an IgE signal peptide, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsert3xFLAG-tagged DR18
UseLentiviralTags3xFLAGExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a spnull-3xFLAG-DR18 IRES mNeonGreen-P2A-Puro
Plasmid#248037PurposeConstitutively expresses 3xFLAG tagged DR18, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsert3xFLAG-tagged DR18
UseLentiviralTags3xFLAGExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a ACCx2 uORF eIL12 IRES mNeonGreen-P2A-Puro
Plasmid#248035PurposeConstitutively expresses an engineered version of IL12, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsertEngineered IL12
UseLentiviralExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a spnull-3xFLAG-Neo2/15 IRES mNeonGreen-P2A-Puro
Plasmid#248033PurposeConstitutively expresses 3xFLAG tagged Neoleukin 2/15, mNeonGreen and a puromycin resistance gene in human cellsDepositorInsert3xFLAG-tagged Neoleukin-2/15
UseLentiviralTags3xFLAGExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChRmine-ST-P2A-H2B-mRuby3
Plasmid#227779PurposeCation channelrhodopsin ChRmine targeted to the neuronal soma and proximal dendrites in a viral vectorDepositorInsertDIO-ChRmine-ST-P2A-H2B-mRuby3
UseAAVExpressionMammalianAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AscI-CAG-H2B-mBaoJin
Plasmid#229576PurposeExpresses H2B-mBaoJin in mammalian cellsDepositorInsertmBaoJin
UseAAVExpressionMammalianAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mNeonGreen-P2A-FusionRed
Plasmid#229570PurposeExpresses mNeonGreen and FusionRed in mammalian cellsDepositorInsertmNeonGreen
UseAAVExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S/S85C/A120L
Plasmid#238112Purposebacterial expression of human TTR mutantDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only