We narrowed to 11,689 results for: VARS
-
Plasmid#191066Purposeceh-24 fluorescent neural reporter driving nuclear CYOFP expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pNHT7
Plasmid#186753PurposeA basic cloning vector for inserting genes with 5' and 3' UTRs for later subcloning via Golden Gate assembly.DepositorTypeEmpty backboneUseSynthetic Biology; Cloning backbonePromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
KEE
Plasmid#187419PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectPromoterPH and p10Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
SNG
Plasmid#187424PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectPromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
OST
Plasmid#187422PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectPromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TEG
Plasmid#187421PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectPromoterPH and p10Available SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
FER
Plasmid#187418PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectPromoterPH and p10Available SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
CHI
Plasmid#187417PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectPromoterPH and p10Available SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
MBP_Lims (MBP_LIM1234)
Plasmid#182042PurposeFor expression of human paxillin LIM domains 1-4 with N-terminal MBP fusion protein in E. Coli.DepositorAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
GST_LIM234
Plasmid#182039PurposeFor expression of human paxillin LIM domains 2-4 with N-terminal GST fusion protein in E. coli.DepositorAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-RiboJ-mTFP1-T7
Plasmid#173225PurposeEncodes mTFP fluorescent protein. To be used in cell-free systemDepositorInsertmTFP1
UseCell-free systemExpressionBacterialPromoterT7Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFGC-T7RibJ-RRvT
Plasmid#173226PurposeEncodes RRvT fluorescent protein. To be used in cell-free systemDepositorInsertRRvT
UseCell-free systemExpressionBacterialPromoterT7Available SinceMarch 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDSARN-vasa-eSpCas9sv40
Plasmid#173670PurposeeSpCas9 expression vector for AnophelesDepositorInserteSpCas9 with Anopheles vasa promoter and SV40 terminator
UseCRISPRExpressionInsectMutationmutations in Cas9 reducing off-target activity (S…PromotervasaAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-stm2585
Plasmid#174391PurposeS. Typhimurium gene stm2585 (sarA/steE) codon-optimized for mammalian expression with N-terminal Flag tagDepositorInsertstm2585
TagsFlagExpressionMammalianAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1972 - [1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
Plasmid#159844PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2301 - [1-2] ENTR - Fluor - ce-mMaple3(1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159865PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mMaple3(1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2
Plasmid#113967PurposeSingle short guide RNA targeting TACCACATTTGTAGAGGTTDepositorInsertsg2
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg3
Plasmid#113968PurposeSingle short guide RNA targeting CAATGTATCTTATCATGTCDepositorInsertsg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2+sg3
Plasmid#113970PurposeDouble short guide RNA targeting TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 mSmoothened NQ4
Plasmid#126407PurposeExpression of Smoothened NQ4 in mammalian cell lines.DepositorAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 mSmoothened NQ3
Plasmid#126406PurposeExpression of Smoothened NQ3 in mammalian cell lines.DepositorAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDB367
Plasmid#110277PurposegHEEE_02 with a N-terminal 10-His DsbC TEV-peptide fusionDepositorInsertgHEEE_02
Tags10-His, Tev recognition peptide, and mature DsbC …ExpressionBacterialPromoterT7Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_TJP3-1/1
Plasmid#91545PurposeProtein expression and purification of human SH3 domain construct TJP3-1/1DepositorInsertTJP3-1/1 (TJP3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_RAB4B-2/2
Plasmid#91554PurposeProtein expression and purification of human SH3 domain construct RAB4B-2/2DepositorInsertRAB4B-2/2 (RAB4B Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NCF4-1/1
Plasmid#91561PurposeProtein expression and purification of human SH3 domain construct NCF4-1/1DepositorInsertNCF4-1/1 (NCF4 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_MPP5-1/1
Plasmid#91562PurposeProtein expression and purification of human SH3 domain construct MPP5-1/1DepositorInsertMPP5-1/1 (PALS1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_STAC-1/2
Plasmid#91527PurposeProtein expression and purification of human SH3 domain construct STAC-1/2DepositorInsertSTAC-1/2 (STAC Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_MPP6-1/1
Plasmid#91531PurposeProtein expression and purification of human SH3 domain construct MPP6-1/1DepositorInsertMPP6-1/1 (PALS2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_RP5-862P8.2-1/1
Plasmid#91537PurposeProtein expression and purification of human SH3 domain construct RP5-862P8.2-1/1DepositorInsertRP5-862P8.2-1/1
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NGEF-1/1
Plasmid#91511PurposeProtein expression and purification of human SH3 domain construct NGEF-1/1DepositorInsertNGEF-1/1 (NGEF Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_MYO15B-1/1
Plasmid#91512PurposeProtein expression and purification of human SH3 domain construct MYO15B-1/1DepositorInsertMYO15B-1/1 (MYO15B Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SORBS3-3/3
Plasmid#91514PurposeProtein expression and purification of human SH3 domain construct SORBS3-3/3DepositorInsertSORBS3-3/3 (SORBS3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_MPP7-1/1
Plasmid#91516PurposeProtein expression and purification of human SH3 domain construct MPP7-1/1DepositorInsertMPP7-1/1 (MPP7 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SAMSN1-1/1
Plasmid#91486PurposeProtein expression and purification of human SH3 domain construct SAMSN1-1/1DepositorInsertSAMSN1-1/1 (SAMSN1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_TJP1-1/1-SV2/2
Plasmid#91494PurposeProtein expression and purification of human SH3 domain construct TJP1-1/1-SV2/2DepositorInsertTJP1-1/1-SV2/2 (TJP1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SH3PXD2A-2/5
Plasmid#91500PurposeProtein expression and purification of human SH3 domain construct SH3PXD2A-2/5DepositorInsertSH3PXD2A-2/5 (SH3PXD2A Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SH3PXD2A-4/5
Plasmid#91471PurposeProtein expression and purification of human SH3 domain construct SH3PXD2A-4/5DepositorInsertSH3PXD2A-4/5 (SH3PXD2A Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PRMT2-1/1
Plasmid#91475PurposeProtein expression and purification of human SH3 domain construct PRMT2-1/1DepositorInsertPRMT2-1/1 (PRMT2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only