We narrowed to 14,223 results for: Cas9
-
Plasmid#173758PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA390aDepositorInsertCas9_sgRNA1/390a_sgRNA2/390a
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
1098E=TI-pgSIT[tra,bTub,Hasp70Bb-Cas9]
Plasmid#149427PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[TraB, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL1P1_AtU626Ter26
Plasmid#191769PurposeCas9 guide expression in dicotsDepositorInsertSpCas9 guide scaffold with AtU626 promoter/terminator
UseCRISPRExpressionPlantAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL1P3_AtU626Ter26
Plasmid#191771PurposeCas9 guide expression in dicotsDepositorInsertSpCas9 guide scaffold with AtU626 promoter/terminator
UseCRISPRExpressionPlantAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiH (CRONUS-Hygro)
Plasmid#100597PurposepiggyBac vector expressing Dual-regulated Cas9 (Hygro resistance)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available sinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCJJ125
Plasmid#117515PurposeCas9_3 (with intron) Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_3(intron):GCTT:BsaI
UseCRISPRTags2xFLAG and NLSExpressionPlantAvailable sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSMVP-Cas9N
Plasmid#80934PurposePlasmid that expresses Cas9N in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9N
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-U6-sgCTG-CAG-Cas9D10A nickase-Blast
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorPublicationInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK294 (mAID-mCherry2-Bsr)
Plasmid#72832PurposeC-terminal tagging with mAID-mCherry2 using CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmAID-mCherry2-Bsr
UseCRISPRTagsmAID-mCherry2ExpressionMammalianAvailable sinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DDX4-cterm
Plasmid#222520PurposeCas9/sgRNA plasmid for targeting DDX4DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9, DDX4 sgRNA (DDX4 Human, Synthetic)
UseCRISPRAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9(D10A)-iP-A
Plasmid#60600PurposeExpresses D10A mutant (nickase) of human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCRISPR Cas9 D10A
puromycin resistance gene
UseCRISPRExpressionMammalianMutationChanged Asp 10 to Ala, Codon usage optimized for …Available sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
HeFm2SpCas9
Plasmid#92111PurposeExpression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert“Highly enhanced Fidelity” mut2 SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060APromoterCbhAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE_16 - pLenti_EFS-Cas9-BLM(1-193)-2A-BlastR
Plasmid#252012PurposeLentiviral mammalian expression of Cas9-BLM(2-194) TruEditorDepositorPublicationInsertCas9-BLM(2-194)
UseCRISPR and LentiviralMutationNAAvailable sinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-miRFP670nano-PGK-Blast
Plasmid#196722PurposeTet-inducible expression of Cas9-T2A-miRFP670nanoDepositorInsertCas9-T2A-miRFP670nano
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSPromoterTRE, PGKAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCC_09 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dCas9-NLS-2A-Puro-WPRE
Plasmid#139094PurposeExpresses human codon-optimized inactive SpCas9 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840AAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by