We narrowed to 14,969 results for: invs
-
Plasmid#162611PurposeAllows for transcription of mVenus fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianMutationPromoterAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
UseTagsExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-{CMV-CuO}>{PAX3::FOXO1}:T2A:mCherry
Plasmid#236629PurposePuromycin selected lentiviral construct with cumate-inducible PAX3::FOXO1DepositorUseLentiviralTagsExpressionMammalianMutationPromoterCMV-CuOAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2ExpressionMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLentiCRISPR V2 Neo sgITGB1_3
Plasmid#233250PurposeKnock out of murine ITGB1DepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 Neo sgITGB1_2
Plasmid#233249PurposeKnock out of murine ITGB1DepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737
Plasmid#222472PurposeLuciferase vector containing the hs737 enhancer sequence (reference sequence).DepositorInserths737 enhancer (reference sequence) (LOC110120928 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-total_SigP:NLuc
Plasmid#197267PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (both isoforms). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-total homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_NLuc_FRT-PuroR
Plasmid#177865PurposeCloning Backbone for NanoLuc-luciferase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertNLuc-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianMutationPromoterAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_BSD_FRT-PuroR
Plasmid#177867PurposeCloning Backbone for Blasticidin-S-deaminase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertBSD-based EXSISERS
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsOLLASExpressionMammalianMutationPromoterAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_SurfaceHaloTag_FRT-PuroR
Plasmid#177869PurposeCloning Backbone for Surface-HaloTag-based EXSISERS containing FRT-sites flanked PuroR cassette; clone homology arms via BbsI (or BpiI).DepositorInsertSurface-HaloTag-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsExpressionMammalianMutationPromoterAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion C-terminus replaced NBCe C-terminus (NT94)
Plasmid#50912PurposeExpresses human NKCC1 with truncation of N-terminus, mutations at P676C I730C and C-terminus replaced with that of NBCe. Contains an N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationP676C and I730C; N-term deletion of aa13-222; C-t…PromoterCMVAvailable SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N-terminus T,S mutations P676C I730C (NT95)
Plasmid#50913PurposeExpresses human NKCC1 with mutated Ser and Thr residues in the N-terminus and mutations at P676C I730C. Contains N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationS150N S155Q S170Q T177A S183R S193E T203A T205A T…PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianMutationPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIN-TRE-H2BeGFP-rtTA2
Plasmid#165494PurposeDoxycycline-inducible all-in-one lentivirus vector to express H2BeGFP fusion protein. System for labelling slow-cycling cells in vivo.DepositorInsertHuman histone H2B (H2BC21 Human)
UseLentiviralTagsEGFPExpressionMutation-PromoterTetO-CMVAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 human PP2A Aα full length
Plasmid#132634Purposeexpresses human PP2A Aα full length in E. coliDepositorAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only