We narrowed to 19,358 results for: comp
-
Plasmid#74632PurposeCan be used to drive expression specifically in zebrafish motor neuronsDepositorInsertmotor neuron and pancreas homeobox 1 promoter (mnx1 Zebrafish)
Use5' entry vector for multisite gateway three …Promoter-3mnx1Available SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flag WDR24 pRK5
Plasmid#46334DepositorAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
PNLM-pcABE
Plasmid#237618PurposePNLM-pcABE generated by pre-trained Protein-Nucleic Acid constrained Language Model exhibits high efficiency, a condensed editing window, and a shortened size.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPRExpressionMammalianMutationdeleted amino acids 2-8 and 147-152PromoterpCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Centrobin
Plasmid#136829PurposeMammalian expression of the centrosomal protein Centrombin N-terminally fused to SNAP-tagDepositorInsertSNAP-Centrobin (CNTROB Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-Turbo-YFP-NLS
Plasmid#127368PurposeBinary vector for expressing nuclear TurboID-YFP under the UBQ10 promoter in plantsDepositorInsertTurboID (BirA mutant)
TagsGS linker, NLS, V5, and YFPExpressionPlantMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE-EGFP-THAP11-rescue-3xFLAG
Plasmid#37000DepositorInsertTHAP11 (THAP11 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_nV5-AMOT (p130)
Plasmid#172997Purposeconstitutive expression of V5-tagged AMOT (p130)DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIVT/CamKII gamma CA
Plasmid#122142PurposeFor making constitutively active CamKII gamma RNADepositorInsertconstitutively active CamKII gamma (Camk2g Mouse)
UseFor in vitro transcriptionMutationFirst 291 amino acid residues of CaMKII gammaPromoterT7Available SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only