171,035 results
-
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF1019
Plasmid#143743PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-TaGRF-GIF-9
Plasmid#197747PurposePhytobrick (MoClo) Level 0 PartDepositorInsertTaGRF-GIF chimeric protein CDS
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0760
Plasmid#141688PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB1a2+pNOS_Red-F_NOSt
Plasmid#170887PurposeGoldenBraid Transcriptional Unit - pNOS_Red-F_NOSt Forward orientationDepositorInsertRed-F
UseLuciferase and Synthetic BiologyExpressionPlantMutationp.S286Y Red mutantPromoterpNOSAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p6xUAS (GB0179)
Plasmid#68182PurposeProvides 6xUAS (upstream activating sequence) as a level 0 GoldenBraid partDepositorInsert6xUAS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBa.M6PR-GFP
Plasmid#224407PurposeMammalian expression of M6PRDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6s.WPRE.SV40
Plasmid#100842PurposeAAV expression of Cre recombinase-activated ultrasensitive protein calcium sensor from CAG promoterDepositorHas ServiceAAV1, AAV5, and AAV9InsertGCaMP6s
UseAAVExpressionMammalianMutationGCaMP3-K78H T302L R303P D380Y T381R S383T R392GPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
CiDr-VSP L223F-mCherry pcDNA3.1 (eVSP)
Plasmid#140892PurposeExpresses modified Danio rerio VSP with enhanced phosphatase activity fused with mCherry in mammalian cells.DepositorTagsmCherryExpressionMammalianMutationchanged 223L to F in Dr-VSP (zebrafish TPTE)Available SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only