We narrowed to 705 results for: pLKO.1
-
Plasmid#27161PurposeLentiviral shRNA vector for knockdown of both mouse MKL1 and MKL2.DepositorInsertshRNA MKL1+2
UseLentiviral and RNAiExpressionMammalianAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 RagB shRNA #2
Plasmid#26628DepositorAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 EB1 shRNA #3
Plasmid#37927DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU1-3'UTR
Plasmid#136049PurposeSTAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-3'UTR
Plasmid#136041PurposeUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-2
Plasmid#193695PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-3
Plasmid#193696PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-4
Plasmid#193697PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-5
Plasmid#193698PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU2-3'UTR
Plasmid#136051PurposeSTAU2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCAGGTAGTTGTTAGTGTTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-2
Plasmid#193693PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-2
Plasmid#193700PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-3
Plasmid#193701PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-3'UTR
Plasmid#136052PurposeREG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)DepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro shSlp4-a #2
Plasmid#40070DepositorInsertSlp4-a shRNA-2
UseLentiviralPromoterU6Available SinceOct. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 - TRC cloning vector
Plasmid#10878Purpose3rd generation transfer plasmidDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Puro shRNA Scramble
Plasmid#162011PurposeLentiviral negative control vector containing scramble shRNADepositorInsertscramble shRNA
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only