-
Plasmid#65304Purposesynchronize trafficking of Golgin-84 from the ER (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
UseTagsStreptavidin Binding Protein (SBP) and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMis1_1B
Plasmid#192079PurposeA pBBR-1 based vector with IncP group plasmid compatibility for expression in Methylorubrum extorquens using rhamnose dependent inductionDepositorInsertsKanR
rhaR
rhaS
pBBR1 rep
UseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGGD_MiniTurboID-YFP
Plasmid#222434PurposeGolden Gate / Green Gate module for adding MiniTurboID and YFP as C-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPExpressionMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGGB_YFP-MiniTurboID
Plasmid#222433PurposeGolden Gate / Green Gate module for adding YFP and MiniTurboID as N-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPExpressionMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Str-Ii_SBP-EGFP-Golgin84
Plasmid#65303Purposesynchronize trafficking of Golgin-84 from the ER (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
UseTagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pT7-EGFP-C1-HsDCP2-E148Q_U
Plasmid#147650PurposeMammalian Expression of HsDCP2-E148QDepositorInsertHsDCP2-E148Q (DCP2 Human)
UseTagsExpressionMammalianMutationtwo silent mutations compared to the sequence giv…PromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HsNot4_AA
Plasmid#148255PurposeMammalian Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
UseTagsExpressionMammalianMutationone silent mutation compared to the sequence give…PromoterAvailable sinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-TagRFP-OcsT
Plasmid#71270PurposeEntry clone containing TagRFP. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTags4xGly linker and octaline synthase terminatorExpressionMutationPromoterAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRL838
Plasmid#70680PurposeThis vector was used to generate a library of ca. 17-kb sequences of clones as part of a genomic sequence strategy and were then used to complement mutations.DepositorTypeEmpty backboneUseCre/LoxTagsExpressionMutationPromoterAvailable sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a_G
Plasmid#146400PurposeMammalian Expression of HsDcp1aDepositorInsertHsDcp1a (DCP1A Human)
UseTagsExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…PromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot4-GB1His6_AG
Plasmid#148792PurposeBacterial Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
UseTagsExpressionBacterialMutationone silent mutation compared to the sequence give…PromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
Plasmid#210504Purposeexpresses NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry component in mammalian cellsDepositorInsertNES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
UseTagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…PromoterAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
UseTagsExpressionBacterialMutationPromoterPatoMAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-NRBF2 (1-159)
Plasmid#99331PurposeMammalian expression of the monomeric form of NRBF2 that binds with the PI3K C1 complexDepositorInsertNuclear receptor-binding factor 2 (NRBF2 Human)
UseTags6xHis-MBP-TEVExpressionBacterialMutationAA1-159 are presentPromoterT7Available sinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only