We narrowed to 41,056 results for: LAT
-
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
FCHo1-pmCherryC1
Plasmid#27690DepositorAvailable SinceMay 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS10_K139R
Plasmid#127137DepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS10_K138R
Plasmid#127136DepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
[pSK600] pRK5 HA-Nprl2(R78A)
Plasmid#136146Purposemammalian expression of Nprl2DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFUGW NLS-Cre
Plasmid#183425PurposeLentiviral Cre vectorDepositorInsertNLS-Cre
UseLentiviralExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYFP
Plasmid#175592PurposeTet inducible, KAN Resistant, mVenus gene on a low copy backbone. Used as a negative control to the pRelA_YFP plasmid.DepositorInsertmVenus
ExpressionBacterialMutationAn improved monomeric YFP. See doi: 10.1021/bi051…Available SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TET-GFP-recipient
Plasmid#11655Purpose3rd generation lentiviral transfer vector. pPRIME-mating recipient plasmid with a tetracycline-responsive promoter (TET) controlling GFP expressionDepositorTypeEmpty backboneUseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBS Olfactomedin1
Plasmid#19225DepositorInsertOlfactomedin 1 (OLFM1 Chicken)
ExpressionBacterialAvailable SinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits only